The small RNA cDNA libraries were made as described (Grimson et al. 2008), except for the 3' adaptor ligation, which was 5' adenylated pTCGTATGCCGTCTTCTGCTTGidT. For a detailed protocol, see http://web.wi.mit.edu/bartel/pub/protocols.html.
Library strategy
miRNA-Seq
Library source
transcriptomic
Library selection
size fractionation
Instrument model
Illumina Genome Analyzer
Description
sample name: FC4004.3
Data processing
Small RNA sequences 16-27 nt long are provided with the number of reads for each unique sequence. Small RNA 5p ends were observed as the 5p end of the Illumina read. Small RNA 3p ends were determined using matches to ligated linker sequences.