|
| Status |
Public on Nov 13, 2010 |
| Title |
Lag1_omegaUV5zf_rep1 |
| Sample type |
SRA |
| |
|
| Source name |
B1H selection; homeodomain protein: Lag1
|
| Organism |
Drosophila melanogaster |
| Characteristics |
homeodomain protein: Lag1
iptg concentration: 10 uM
3-at concentration: 5mM
duration of experiment: 36-48 hours
bait_plasmid variant: omegaUV2zf
|
| Extracted molecule |
other |
| Extraction protocol |
After each selection, all of the cells were scraped of the plate. The randomized portion of the prey vector containing the selected transcription factor binding sites were extracted and amplified using PCR. The PCR products from different experiments were digested with different restriction enzymes in the first step of uniquely encoding sequences from different experiments. The restriction enzyme fragments were then barcoded, pooled and sequenced using the Illumina Genome Analyzer II or IIx. the supplemental material of Noyes et al. (2008). Cell. 133(7):1277-1289 for a more detailed description of the experimental protocol employed.
|
| |
|
| Library strategy |
OTHER |
| Library source |
synthetic |
| Library selection |
other |
| Instrument model |
Illumina Genome Analyzer IIx |
| |
|
| Data processing |
Two barcoded, multiplexed samples were sequenced using Illumina Genome Analyzer machines. Each experiment was associated with one or more expected sequence. Expected sequences were determined based on the restriction enzyme and barcode used to uniquely identify each experimental sample. Each read was assigned to an experiment if it matched the constant region of an expected sequence exactly. Reads that did not match one of the expected sequences exactly were placed in the 'unassigned' category.
The Sample tables contain two columns. The first column contains all of the observed unique randomized regions for an experiment. The second column contains an integer values which indicates the number of times each unique randomized region was observed.
Note: Randomized regions which contained 'N' characters were discarded. Only reads which matched an expected sequence exactly were considered. The sequences from multiple experiments were pooled and multiplexed. The sequences from each experiment were uniquely labeled using a combination of different restriction enzymes and different barcodes. The expected sequence for each experimental data set is determined by the restriction enzyme and barcode used. In order to be assigned to a specific experiment, a read had to match an expected sequence exactly at all constant (i.e. non randomized) bases. For example, the expected sequence for the Zen2_omegaUV2zf_rep1 data set is GGTCATGGATCCNNNNNNNNNNTGGGCGGCTGATAG. The read GGTCATGGATCCGTCCAGATTGTGGGCGGCTGATAG matches the expected sequence for Zen2_omegaUV2zf_rep1, but the sequence GGTCATGGATCCGTCCAGATTGTGGGCAAAAAAAAA does not.
|
| |
|
| Submission date |
Nov 12, 2010 |
| Last update date |
Jun 11, 2013 |
| Contact name |
Scot Wolfe |
| E-mail(s) |
scot.wolfe@umassmed.edu
|
| Organization name |
UMass Medical School
|
| Department |
MCCB
|
| Street address |
364 Plantation Street, LRB 619
|
| City |
Worcester |
| State/province |
MA |
| ZIP/Postal code |
01605 |
| Country |
USA |
| |
|
| Platform ID |
GPL11203 |
| Series (1) |
| GSE25312 |
High-througput Bacteria one hybrid (B1H) selections for all Drosophila homeodomain proteins |
|
| Relations |
| BioSample |
SAMN02197124 |
