|
Status |
Public on Dec 05, 2011 |
Title |
Bisulfite-Seq analysis of RRBS1079 derived from human fetal brain cells; RRBS1079 |
Sample type |
SRA |
|
|
Source name |
Fetal Brain primary tissue, day 122; RRBS1079
|
Organism |
Homo sapiens |
Characteristics |
sample alias: fBrain.H-22510d122 sample common name: Fetal Brain molecule: genomic DNA disease: None biomaterial_provider: University of Washington, Congenital Defects Lab. Ian Glass biomaterial_type: Primary Tissue tissue_type: fetal brain tissue_depot: UW collection_method: fetal donor_id: H-22510 donor_age: 122 days donor_health_status: NA donor_sex: Male donor_ethnicity: NA bisulfite_conversion_protocol: 2x5hrs Epitect Kit dna_preparation_initial_dna_qnty: 20 ng extraction_protocol_sonication_cycles: NA dna_preparation_adaptor_ligation_protocol: T4 Ligase (2,000U/ul) 16C o/n dna_preparation_adaptor_sequence: 5' P-GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG and 5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT library_generation_pcr_r_primer_sequence: 5' CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT dna_preparation_post-ligation_fragment_size_selection: 120-370 bisulfite_conversion_percent: >99% extraction_protocol: Standard Protocol (Smith et al., Methods 48, 226-232) library_generation_pcr_primer_conc: 25uM dna_preparation_fragment_size_range: 30-280 experiment_type: DNA Methylation library_generation_pcr_thermocycling_program: Smith et al., Methods 48, 226-232 library_generation_pcr_product_isolation_protocol: Gel size selection library_generation_pcr_f_primer_sequence: 5' AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT library_generation_pcr_template_conc: NA library_generation_pcr_polymerase_type: Pfu Turbo Cx hot start library_generation_pcr_number_cycles: 15 extraction_protocol_type_of_sonicator: NA
|
Extracted molecule |
genomic DNA |
Extraction protocol |
Library construction protocol: Smith et al., Methods 48, 226-232
|
|
|
Library strategy |
Bisulfite-Seq |
Library source |
genomic |
Library selection |
Reduced Representation |
Instrument model |
Illumina Genome Analyzer IIx |
|
|
Description |
sample_term_id: UBERON_0000955 assay_term_id: OBI_0001862 nucleic_acid_term_id: SO_0000352 Design description: RRBS REMC Sequencing on Illumina Library name: RRBS1079 EDACC Genboree Experiment Page: http://genboree.org/java-bin/project.jsp?projectName=XML%20Submissions%2FBroad%2FEXPERIMENT%2FEDACC.6996 EDACC Genboree Sample Page: http://genboree.org/java-bin/project.jsp?projectName=XML%20Submissions%2FUniversity%20of%20Washington%2FSAMPLE%2FEDACC.2448 **************** For data usage terms and conditions, please refer to: http://www.drugabuse.gov/funding/funding-opportunities/nih-common-fund/epigenomics-data-access-policies ****************
|
Data processing |
**********************************************************************
ANALYSIS FILE NAME: GSM706838_BI.Fetal_Brain.RRBS.H-22510.wig ANALYSIS CENTER: EDACC ANALYSIS ALIAS: RRBS1079.hg19.level.2.release.4 ANALYSIS TITLE: Methylation Proportion Graphs of Fetal Brain RRBS Data ANALYSIS DESCRIPTION: Illumina RRBS read mappings from Fetal Brain, Donor H-22510 were processed into graphs of methylation proportions. Methylation proportions were calculated as (methylated calls / (methylated calls + unmethylated calls)) for all CpGs covered by at least 4 reads. ANALYSIS TYPE: ABUNDANCE_MEASUREMENT EDACC Genboree Analysis Page: http://genboree.org/java-bin/project.jsp?projectName=XML%20Submissions%2FEDACC%2FANALYSIS%2FEDACC.8332 DATA_ANALYSIS_LEVEL: 2 EXPERIMENT_TYPE: Reduced Representation Bisulfite-Seq GENOME_ASSEMBLY: NCBI Build GRCh37/UCSC Build hg19 MspI restriction fragments 40-220bp SOFTWARE: In house programs and scripts SOFTWARE_VERSION: NA READ_EXTENSION: 0bp TREATMENT_OF_IDENTICAL_ALIGNMENTS_OF_MULTIPLE_READS: None GENOMIC_WINDOW: 2bp containing CpGs TREATMENT_OF_REGIONS_PRONE_TO_MULTIPLE_ALIGNMENTS: None RELEASE_NUMBER: Human Epigenome Atlas 4 BROWSER_TRACK_NAME: FB RRBS 10 79 BROWSER_TRACK_DESCRIPTION: BI Fetal Brain RRBS Donor H-22510 Library RRBS1079 EA Release 4
QUALITY SCORES: NUMBER_OF_MAPPED_READS: 23,231,079 NUMBER_OF_RRBS_EXPERIMENTS_SCORED_IN_THIS_RELEASE: 21 BISULFITE_CONVERSION_PERCENTAGE_BASED_ON_MAPPINGS: 99.3 BISULFITE_CONVERSION_PERCENTAGE_BASED_ON_MAPPINGS_PERCENTILE: 10 MAXIMUM_REPLICATE_CORRELATION: 0.71
**********************************************************************
|
|
|
Submission date |
Apr 12, 2011 |
Last update date |
Jan 29, 2015 |
Contact name |
BROAD INSTITUTE |
E-mail(s) |
rharris1@bcm.tmc.edu
|
Organization name |
Broad Institute
|
Street address |
-
|
City |
Cambridge |
State/province |
MA |
ZIP/Postal code |
02142 |
Country |
USA |
|
|
Platform ID |
GPL10999 |
Series (1) |
GSE17312 |
BI Human Reference Epigenome Mapping Project |
|
Relations |
BioSample |
SAMN00113444 |
Named Annotation |
GSM706838_BI.Fetal_Brain.RRBS.H-22510.wig.gz |