 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Mar 18, 2014 |
| Title |
Drosophila auto-Hermes |
| Sample type |
SRA |
| |
|
| Source name |
whole adult
|
| Organism |
Drosophila melanogaster |
| Characteristics |
strain: csW+
colony transformation line: Transformed with an intact Hermes element
technical replicate number: N/A
tissue: whole organism
treatment: an intact Hermes element
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Illumina small RNA sample prep kit
|
| |
|
| Library strategy |
OTHER |
| Library source |
non-genomic |
| Library selection |
other |
| Instrument model |
Illumina Genome Analyzer IIx |
| |
|
| Data processing |
For all libraries, the RAW files were processed using custom written PERL and R scripts (availalbe upon request from the authors) or using software described below. Processing workflow:
1) remove adapter sequences on 3' end (5' TCGTATGCCGTCTTCTGCTTG 3') sequences without recognizable adapter sequences were discarded from further analysis
2) remove ribosomal degradation products using BLAT aligner (Kent 2002)
3) map the remaining sequences to the the appropiate genome using the alignment program Bowtie (Langmead et al. 2009). Mapping paramters seed length 30 (-l 30) and up to two mismatches with reference genome (-n 2)
a) for RAW files RNAlib1.fastq, RNAlib2.fastq, RNAlib4.fastq, RNAlib6.fastq, RNAlib10.fastq, RNAlib11.fastq and RNAlib12.fastq mapped to Aedes agegypti genome assembly (AaegL1) hosted by VectorBase
b) for RAW file RNAlib14.fastq mapped to Drosophila melanogaster assembly BDGP release 5
References:
Kent, W. J. 2002. BLAT---The BLAST-Like Alignment Tool.â? Genome Research 12 (March 20): 656-664. doi:10.1101/gr.229202.
Langmead, B., C. Trapnell, M. Pop, and S.L. Salzberg. 2009. Ultrafast and memory-efficient alignment of short DNA sequences to the human genome.â? Genome Biol 10 (3): R25.
|
| |
|
| Submission date |
Nov 09, 2011 |
| Last update date |
May 15, 2019 |
| Contact name |
Peter Arensburger |
| E-mail(s) |
arensburger@gmail.com
|
| Organization name |
California State Polytechnic University Pomona
|
| Department |
Dept. of Biology
|
| Street address |
3801 Watkins Avenue
|
| City |
Pomona |
| State/province |
CA |
| ZIP/Postal code |
91768 |
| Country |
USA |
| |
|
| Platform ID |
GPL11203 |
| Series (1) |
| GSE33595 |
The mosquito Aedes aegypti has a large genome size and high transposable element load but contains a low proportion of transposon-specific piRNAs |
|
| Relations |
| SRA |
SRX105184 |
| BioSample |
SAMN00752403 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM830470_RNAlib14_dmel.bam |
529.7 Mb |
(ftp)(http) |
BAM |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
