|
|
GEO help: Mouse over screen elements for information. |
|
Status |
Public on Jan 21, 2012 |
Title |
Whole genome shotgun bisulf. sequencing: mesenchymal cells derived from H1 embryonic stem cells; methylC-seq_h1-msc_r1a |
Sample type |
SRA |
|
|
Source name |
H1-Mesenchymal Stem Cell Line, biological replicate 1 (r1); methylC-seq_h1-msc_r1a
|
Organism |
Homo sapiens |
Characteristics |
sample alias: H1-MSC_r1 sample common name: H1 Derived Mesenchymal Stem Cells molecule: genomic DNA disease: None biomaterial_provider: Thomson Laboratory biomaterial_type: Cell Line line: H1 lineage: NA differentiation_stage: embryonic stem cell differentiated by treatment with fibronectin and human collagen differentiation_method: H1 cells were cultured on plates coated with fibronectin and human collagen passage: 5 medium: 50% StemLine II serum-free HSC expansion medium (HSFEM; Sigma), 50% ESFM, GlutaMAX (1/100 dilution), Ex-Cyte supplement (1/2000 dilution), 100 mM MTG, and 10 ng/ml FGF2. Sex: Male batch: Replicate 1 experiment_type: DNA Methylation extraction_protocol: Qiagen DNeasy mini kit, performed as per manufacturer's instructions extraction_protocol_type_of_sonicator: Covaris S2 extraction_protocol_sonication_cycles: Standard fragment express, 6 cycles dna_preparation_initial_dna_qnty: 5 µg dna_preparation_fragment_size_range: 100-150 dna_preparation_adaptor_sequence: A: 5' P-GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG, B: 5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT dna_preparation_adaptor_ligation_protocol: 16degC for 16 hours with T4 DNA ligase (New England Biolabs) dna_preparation_post-ligation_fragment_size_selection: Two rounds of purification with AMPure XP beads (Agencourt) bisulfite_conversion_protocol: Invitrogen MethylCode bisulfite_conversion_percent: 99.5% of cytosines converted based on shotgun sequencing of unmethylated lambda phage control spiked into original genomic DNA sample library_generation_pcr_template_conc: >30-100% of the adapter-ligated, bisulfite converted DNA was used in each of three 50 µl PCR reaction library_generation_pcr_polymerase_type: Stratagene Pfu Turbo Cx library_generation_pcr_thermocycling_program: 95degC 2 min; 98degC 30 sec, 4 cycles of 98degC 15 sec, 60degC 30 sec, 72degC 4 min; 72degC 10 min library_generation_pcr_number_cycles: 4 library_generation_pcr_f_primer_sequence: 5' AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT library_generation_pcr_r_primer_sequence: 5' CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT library_generation_pcr_primer_conc: 25 µM library_generation_pcr_product_isolation_protocol: Two rounds of purification with AMPure XP beads (Agencourt)
|
Extracted molecule |
genomic DNA |
Extraction protocol |
Library construction protocol: Five µg of genomic DNA was extracted from frozen cell pellets using the DNeasy Mini Kit (Qiagen, Valencia, CA) and spiked with 25 ng unmethylated cl857 Sam7 Lambda DNA (Promega, Madison, WI). The DNA was fragmented with a Covaris S2 (Covaris, Woburn, MA) to 300-500 bp, followed by concentration and size selection with AMPure XP beads (Beckman Coulter Genomics, Danvers, MA) at 0.9 X volume, then end repair with dCTP-free dNTPs and addition of a 3'A base. Paired-end cytosine methylated adapters (Illumina, San Diego, CA) were ligated to the sonicated DNA at 16degC for 16 hours with T4 DNA ligase (New England Biolabs). Adapter-ligated DNA was isolated by two rounds of purification with AMPure XP beads at 0.9 X volume. Adapter-ligated DNA (450 ng) was subjected to sodium bisulfite conversion using the MethylCode kit (Life Technologies, Carlsbad, CA) as per manufacturer's instructions. The bisulfite-converted, adapter-ligated DNA molecules were enriched by 4 cycles of PCR with the following reaction composition: 2.5 U of uracil-insensitive PfuTurboCx Hotstart DNA polymerase (Stratagene), 5 µl 10X PfuTurbo reaction buffer, 31 µM dNTPs, 1 µl P7 primer (10 µM), 1 µl Primer5+3 (10 µM), for a final reaction volume of 50 µl. The thermocycling parameters were: 95degC 2 min, 98degC 30 sec, then 6 cycles of 98degC 15 sec, 60degC 30 sec and 72degC 4 min, ending with one 72degC 10 min step. The reaction products were purified using AMPure XP beads at 0.9X volume (two rounds). Two separate PCR reactions were performed on subsets of the adapter-ligated, bisulfite-converted DNA, yielding two independent libraries from the same biological sample.
|
|
|
Library strategy |
Bisulfite-Seq |
Library source |
genomic |
Library selection |
RANDOM |
Instrument model |
Illumina HiSeq 2000 |
|
|
Description |
sample_term_id: EFO_0000586 assay_term_id: OBI_0001863 nucleic_acid_term_id: SO_0000352 Design description: Whole genome shotgun bisulfite sequencing of mesenchymal cells derived from H1 embryonic stem cells Library name: methylC-seq_h1-msc_r1a EDACC Genboree Experiment Page: http://genboree.org/java-bin/project.jsp?projectName=XML%20Submissions%2FUCSD%2FEXPERIMENT%2FEDACC.11129 EDACC Genboree Sample Page: http://genboree.org/java-bin/project.jsp?projectName=XML%20Submissions%2FUCSD%2FSAMPLE%2FEDACC.11127 **************** For data usage terms and conditions, please refer to: http://www.drugabuse.gov/funding/funding-opportunities/nih-common-fund/epigenomics-data-access-policies ****************
|
Data processing |
**********************************************************************
ANALYSIS FILE NAME: GSM864032_UCSD.H1_Derived_Mesenchymal_Stem_Cells.Bisulfite-Seq.methylC-seq_h1-msc_r1a.wig ANALYSIS CENTER: EDACC ANALYSIS ALIAS: methylC-seq_h1-msc_r1a.hg19.level.2.release.7 ANALYSIS TITLE: Methylation Proportion Graphs of H1 Derived Mesenchymal Stem Cells Bisulfite-Seq Data ANALYSIS DESCRIPTION: Illumina Bisulfite-Seq read mappings from the H1 Derived Mesenchymal Stem Cells, Library methylC-seq_h1-msc_r1a were processed into graphs of methylation proportions. Methylation proportions were calculated as (methylated calls / (methylated calls + unmethylated calls)) for all CpGs covered by at least 4 reads. Reads from the + and - strands were combined for methylation proportion calculations. ANALYSIS TYPE: ABUNDANCE_MEASUREMENT EDACC Genboree Analysis Page: http://genboree.org/java-bin/project.jsp?projectName=XML%20Submissions%2FEDACC%2FANALYSIS%2FEDACC.12974 DATA_ANALYSIS_LEVEL: 2 EXPERIMENT_TYPE: Bisulfite-Seq GENOME_ASSEMBLY: NCBI Build GRCh37/UCSC Build hg19 SOFTWARE: In house programs and scripts SOFTWARE_VERSION: NA READ_EXTENSION: 0bp TREATMENT_OF_IDENTICAL_ALIGNMENTS_OF_MULTIPLE_READS: If multiple reads map to the same start position on the + strand or stop position on the - strand, only a single read is retained. GENOMIC_WINDOW: 2bp containing CpGs TREATMENT_OF_REGIONS_PRONE_TO_MULTIPLE_ALIGNMENTS: None RELEASE_NUMBER: Human Epigenome Atlas 7 BROWSER_TRACK_NAME: HDMSC BS 1a BROWSER_TRACK_DESCRIPTION: UCSD H1 Derived Mesenchymal Stem Cells Bisulfite-Seq Library methylC-seq_h1-msc_r1a EA Release 7
QUALITY SCORES: NUMBER_OF_MAPPED_READS: 953,202,149 NUMBER_OF_Bisulfite-Seq_EXPERIMENTS_SCORED_IN_THIS_RELEASE: 6 BISULFITE_CONVERSION_PERCENTAGE_BASED_ON_MAPPINGS: 99.02 BISULFITE_CONVERSION_PERCENTAGE_BASED_ON_MAPPINGS_PERCENTILE: 100
**********************************************************************
ANALYSIS FILE NAME: GSM864032_UCSD.H1_Derived_Mesenchymal_Stem_Cells.Bisulfite-Seq.combined.wig ANALYSIS CENTER: EDACC ANALYSIS ALIAS: methylC-seq_h1-msc_r1a-methylC-seq_h1-msc_r2a.hg19.level.2.release.7 ANALYSIS TITLE: Methylation Proportion Graphs of H1 Derived Mesenchymal Stem Cells Bisulfite-Seq Data ANALYSIS DESCRIPTION: Illumina Bisulfite-Seq read mappings from the H1 Derived Mesenchymal Stem Cells combined libraries were processed into graphs of methylation proportions. Methylation proportions were calculated as (methylated calls / (methylated calls + unmethylated calls)) for all CpGs covered by at least 4 reads. Reads from the + and - strands were combined for methylation proportion calculations. ANALYSIS TYPE: ABUNDANCE_MEASUREMENT EDACC Genboree Analysis Page: http://genboree.org/java-bin/project.jsp?projectName=XML%20Submissions%2FEDACC%2FANALYSIS%2FEDACC.12977 DATA_ANALYSIS_LEVEL: 2 EXPERIMENT_TYPE: Bisulfite-Seq GENOME_ASSEMBLY: NCBI Build GRCh37/UCSC Build hg19 SOFTWARE: In house programs and scripts SOFTWARE_VERSION: NA READ_EXTENSION: 0bp TREATMENT_OF_IDENTICAL_ALIGNMENTS_OF_MULTIPLE_READS: If multiple reads map to the same start position on the + strand or stop position on the - strand, only a single read is retained. GENOMIC_WINDOW: 2bp containing CpGs TREATMENT_OF_REGIONS_PRONE_TO_MULTIPLE_ALIGNMENTS: None RELEASE_NUMBER: Human Epigenome Atlas 7 BROWSER_TRACK_NAME: HDMSC BS Combined BROWSER_TRACK_DESCRIPTION: UCSD H1 Derived Mesenchymal Stem Cells Bisulfite-Seq Combined Libraries EA Release 7
QUALITY SCORES: NUMBER_OF_MAPPED_READS: 1,592,748,764 BISULFITE_CONVERSION_PERCENTAGE_BASED_ON_MAPPINGS: 99.01
SPECIAL NOTE: generated from combined data in GSM864032, GSM864033 (thus .wig files on these records are identical)
**********************************************************************
|
|
|
Submission date |
Jan 19, 2012 |
Last update date |
May 15, 2019 |
Contact name |
UCSD AND SALK |
Organization name |
University of California, San Diego
|
Street address |
Health Sciences Drive
|
City |
La Jolla |
State/province |
CA |
ZIP/Postal code |
92092 |
Country |
USA |
|
|
Platform ID |
GPL11154 |
Series (1) |
GSE16256 |
UCSD Human Reference Epigenome Mapping Project |
|
Relations |
Reanalyzed by |
GSE46644 |
SRA |
SRX116603 |
BioSample |
SAMN00774087 |
Named Annotation |
GSM864032_UCSD.H1_Derived_Mesenchymal_Stem_Cells.Bisulfite-Seq.methylC-seq_h1-msc_r1a.wig.gz |
Named Annotation |
GSM864032_UCSD.H1_Derived_Mesenchymal_Stem_Cells.Bisulfite-Seq.combined.wig.gz |
Supplementary file |
Size |
Download |
File type/resource |
GSM864032_UCSD.H1_Derived_Mesenchymal_Stem_Cells.Bisulfite-Seq.combined.wig.gz |
192.0 Mb |
(ftp)(http) |
WIG |
GSM864032_UCSD.H1_Derived_Mesenchymal_Stem_Cells.Bisulfite-Seq.methylC-seq_h1-msc_r1a.wig.gz |
173.8 Mb |
(ftp)(http) |
WIG |
SRA Run Selector |
Raw data are available in SRA |
Processed data provided as supplementary file |
|
|
|
|
|