NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM875276 Query DataSets for GSM875276
Status Public on Feb 15, 2012
Title 76_AAA_RAQWF
Sample type SRA
 
Source name synthetic library--Z10 library
Organism synthetic construct
Characteristics library: Z10 library
library selection: bacterial one-hybrid (B1H) selected
Growth protocol For each selection using the HD library at least 1x108 dual transformants (of HD expression vector and binding site reporter vector into the selection strain) were plated on NM media supplemented with 1uM IPTG and 200uM uracil. The stringency of each selection was adjusted such that 1000-2000 colonies were recovered. For each selection using the ZF10 libaray selections was performed that all selections were plated on NM media supplemented with 5mM 3-AT, 1uM IPTG, and 200uM uracil.
Extracted molecule other
Extraction protocol For HD library-- Surviving colonies from each selection were pooled and prepared for sequencing). HD clones were amplified using a forward primer (CAAGCAGAAGACGGCATACGAGCTCTTCCGATCTATGCTTGCCCTGTCGAGTCC) and reverse primer (CTTAATGCGCCGCTACAGGGC), where the forward primer incorporated the Illumina P2-adapter sequence. Each PCR product was then digested with either BamHI or XbaI for the ligation of barcoded P1 adapters prior to Illumina library generation and sequencing. Recovered ZF10 library members were identified via Illumina sequencing, the initial PCR product was digested with either BamHI or NcoI for the ligation of barcoded P1 adaptors (Table S1 & S5).
 
Library strategy OTHER
Library source other
Library selection other
Instrument model Illumina HiSeq 2000
 
Description selected from the bacterial-one hybrid system
molecule: plasmid DNA
Data processing Each fasta line represents a unique sequence identified where the HD interacts with that DNA sequence.
 
Submission date Feb 14, 2012
Last update date May 15, 2019
Contact name Scot Wolfe
E-mail(s) scot.wolfe@umassmed.edu
Organization name UMass Medical School
Department MCCB
Street address 364 Plantation Street, LRB 619
City Worcester
State/province MA
ZIP/Postal code 01605
Country USA
 
Platform ID GPL15228
Series (1)
GSE35806 Exploring the DNA-Recognition Potential of Homeodomains
Relations
SRA SRX119874
BioSample SAMN00789015

Supplementary file Size Download File type/resource
GSM875276_76_AAA_RAQWF_Top1000withTies_fasta.txt.gz 6.8 Kb (ftp)(http) TXT
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap