|
Status |
Public on Dec 30, 2012 |
Title |
PMAIP uninduced 4C |
Sample type |
SRA |
|
|
Source name |
PMAIP uninduced
|
Organism |
Homo sapiens |
Characteristics |
cell line: DL23 cell type: DLD1 colon carcinoma
|
Treatment protocol |
cells are cross linked using 1% formaldehyde for 10minutes at room temperature
|
Growth protocol |
DL23 cells were grown on RPMI-1640 medium with 10% FCS and standard supplements. 4-hydroxy-tamoxifen (4OHT) from Sigma, was dissolved in ethanol and added to cells at a final concentration of 1uM.
|
Extracted molecule |
genomic DNA |
Extraction protocol |
4C procedure, as published before (Splinter et al., 2001, Genes Dev). Cells are cross linked using 1% formaldehyde for 10min at room temperature, nuclei are isolated, after which chromatin is digested with DpnII and subsequently ligated under diluted conditions. After reversal of the cross links the DNA is purified and treated with the second restriction enzyme treatment (Csp). After a second re-ligation step the sample is purified and a 4C PCR is applied.
|
|
|
Library strategy |
OTHER |
Library source |
genomic |
Library selection |
other |
Instrument model |
Illumina HiSeq 2000 |
|
|
Description |
barcode: ACAACTCTCTAACGTTGATC
|
Data processing |
Library strategy: 4C-Seq The initial step in the 4C-seq analysis is the alignment of the sequencing reads to a reduced genome of sequences that flank DpnII sites (fragment ends), using custom perl scripts. Due to their ambiguous nature in reporting contacts, repetitive fragment ends were excluded from subsequent analysis. The reduced genome was based on hg19. Genome_build: hg19 Supplementary_files_format_and_content: Processed data files are in wiggle track format. Entries in the wiggle track represent genomic regions that overlap with DpnII fragment ends. Only for DpnII fragments ends for which a sequence capture is found a value is reported.This value represents read count. For a correct analysis a comparison must be made to a full set of DpnII restriction sites (not provided).
|
|
|
Submission date |
Mar 27, 2012 |
Last update date |
May 15, 2019 |
Contact name |
Elzo de Wit |
Phone |
+31 30 2121 800
|
Organization name |
Hubrecht Institute
|
Street address |
Uppsalalaan 8
|
City |
Utrecht |
ZIP/Postal code |
3584 CT |
Country |
Netherlands |
|
|
Platform ID |
GPL11154 |
Series (1) |
GSE36835 |
FOXO3 regulates gene expression from distal enhancers |
|
Relations |
SRA |
SRX131882 |
BioSample |
SAMN00839671 |