NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM902745 Query DataSets for GSM902745
Status Public on Dec 30, 2012
Title SESN3 uninduced 4C
Sample type SRA
 
Source name SESN3 uninduced
Organism Homo sapiens
Characteristics cell line: DL23
cell type: DLD1 colon carcinoma
Treatment protocol cells are cross linked using 1% formaldehyde for 10minutes at room temperature
Growth protocol DL23 cells were grown on RPMI-1640 medium with 10% FCS and standard supplements. 4-hydroxy-tamoxifen (4OHT) from Sigma, was dissolved in ethanol and added to cells at a final concentration of 1uM.
Extracted molecule genomic DNA
Extraction protocol 4C procedure, as published before (Splinter et al., 2001, Genes Dev). Cells are cross linked using 1% formaldehyde for 10min at room temperature, nuclei are isolated, after which chromatin is digested with DpnII and subsequently ligated under diluted conditions. After reversal of the cross links the DNA is purified and treated with the second restriction enzyme treatment (Csp). After a second re-ligation step the sample is purified and a 4C PCR is applied.
 
Library strategy OTHER
Library source genomic
Library selection other
Instrument model Illumina HiSeq 2000
 
Description barcode: GAGCTAAATATTTCCTGATC
Data processing Library strategy: 4C-Seq
The initial step in the 4C-seq analysis is the alignment of the sequencing reads to a reduced genome of sequences that flank DpnII sites (fragment ends), using custom perl scripts. Due to their ambiguous nature in reporting contacts, repetitive fragment ends were excluded from subsequent analysis. The reduced genome was based on hg19.
Genome_build: hg19
Supplementary_files_format_and_content: Processed data files are in wiggle track format. Entries in the wiggle track represent genomic regions that overlap with DpnII fragment ends. Only for DpnII fragments ends for which a sequence capture is found a value is reported.This value represents read count. For a correct analysis a comparison must be made to a full set of DpnII restriction sites (not provided).
 
Submission date Mar 27, 2012
Last update date May 15, 2019
Contact name Elzo de Wit
Phone +31 30 2121 800
Organization name Hubrecht Institute
Street address Uppsalalaan 8
City Utrecht
ZIP/Postal code 3584 CT
Country Netherlands
 
Platform ID GPL11154
Series (1)
GSE36835 FOXO3 regulates gene expression from distal enhancers
Relations
SRA SRX131886
BioSample SAMN00839675

Supplementary file Size Download File type/resource
GSM902745_SESN3_nt.wig.gz 37.9 Kb (ftp)(http) WIG
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap