|
| Status |
Public on May 15, 2012 |
| Title |
PAR-CLIP CF Im59 |
| Sample type |
SRA |
| |
|
| Source name |
HEK293, CF Im59 CLIP
|
| Organism |
Homo sapiens |
| Characteristics |
cell line: HEK293
genotype/variation: stably transformed to produce FLAG-tagged protein
crosslinker and crosslinking wavelength: 4-SU / 365 nm
antibody: monoclonal anti-FLAG M2
antibody vendor: SIGMA
antibody catalog number: F1804
antibody lot number: 088K6018
|
| Growth protocol |
HEK293 cells were routinely grown in DMEM supplemented with 10% FCS in the presence of antibiotics.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
We crosslinked 4-thio-uridine-containing RNA to proteins with 365nm UV light (as in PAR-CLIP) to readily identify crosslinked positions based on the abundant crosslink-diagnostic mutations. We then employed the steps of nuclease digestion, primer ligation and blotting of immunoprecipitated complexes to nitrocellulose from the HITS-CLIP method, to minimize cloning of background RNA. Immunoprecipitation (IP) was performed with protein-specific antibodies or with anti-FLAG antibodies when stably transformed cell lines were generated to produce FLAG-tagged proteins.
|
| |
|
| Library strategy |
OTHER |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina Genome Analyzer |
| |
|
| Description |
3' adapter sequence: TCGTATGCCGTCTTCTGCTTGT
|
| Data processing |
Library strategy: CLIP-Seq
The raw reads were processed on the CLIPZ server (www.clipz.unibas.ch; Khorshid et al., Nucleic Acids Research 2011, 39:D245 (PMID 21087992)).
Reads that appeared to be due to spurious mappings of truncated 3' adaptor sequences (showing a perfect 10-mer match to the 3' adaptor sequence) were discarded. For subsequent analysis, we then extracted uniquely mapped reads with annotations "mRNA", "repeat", or "unknown".
Genome_build: hg19, GRCh37 Genome Reference Consortium Human Reference 37
Supplementary_files_format_and_content: Wiggle files; read densities from PAR-CLIP experiments.
|
| |
|
| Submission date |
Apr 18, 2012 |
| Last update date |
May 15, 2019 |
| Contact name |
Andreas R Gruber |
| E-mail(s) |
agruber@tbi.univie.ac.at
|
| Organization name |
University of Basel
|
| Department |
Biozentrum
|
| Lab |
Zavolan
|
| Street address |
Klingelbergstrasse 50-70
|
| City |
Basel |
| ZIP/Postal code |
4056 |
| Country |
Switzerland |
| |
|
| Platform ID |
GPL9052 |
| Series (2) |
| GSE37398 |
Genome-wide analysis of pre-mRNA 3' end processing reveals a decisive role of human cleavage factor I in the regulation of 3' UTR length: CLIP |
| GSE37401 |
Genome-wide analysis of pre-mRNA 3' end processing reveals a decisive role of human cleavage factor I in the regulation of 3' UTR length |
|
| Relations |
| SRA |
SRX143263 |
| BioSample |
SAMN00858115 |
