|
Status |
Public on May 15, 2012 |
Title |
PAR-CLIP CPSF-30 repB |
Sample type |
SRA |
|
|
Source name |
HEK293, CPSF-30 CLIP
|
Organism |
Homo sapiens |
Characteristics |
cell line: HEK293 genotype/variation: stably transformed to produce FLAG-tagged protein crosslinker and crosslinking wavelength: 4-SU / 365 nm antibody: monoclonal anti-FLAG M2 antibody vendor: SIGMA antibody catalog number: F1804 antibody lot number: 088K6018
|
Growth protocol |
HEK293 cells were routinely grown in DMEM supplemented with 10% FCS in the presence of antibiotics.
|
Extracted molecule |
total RNA |
Extraction protocol |
We crosslinked 4-thio-uridine-containing RNA to proteins with 365nm UV light (as in PAR-CLIP) to readily identify crosslinked positions based on the abundant crosslink-diagnostic mutations. We then employed the steps of nuclease digestion, primer ligation and blotting of immunoprecipitated complexes to nitrocellulose from the HITS-CLIP method, to minimize cloning of background RNA. Immunoprecipitation (IP) was performed with protein-specific antibodies or with anti-FLAG antibodies when stably transformed cell lines were generated to produce FLAG-tagged proteins.
|
|
|
Library strategy |
OTHER |
Library source |
transcriptomic |
Library selection |
other |
Instrument model |
Illumina Genome Analyzer |
|
|
Description |
3' adapter sequence: TCGTATGCCGTCTTCTGCTTGT
|
Data processing |
Library strategy: CLIP-Seq The raw reads were processed on the CLIPZ server (www.clipz.unibas.ch; Khorshid et al., Nucleic Acids Research 2011, 39:D245 (PMID 21087992)). Reads that appeared to be due to spurious mappings of truncated 3' adaptor sequences (showing a perfect 10-mer match to the 3' adaptor sequence) were discarded. For subsequent analysis, we then extracted uniquely mapped reads with annotations "mRNA", "repeat", or "unknown". Genome_build: hg19, GRCh37 Genome Reference Consortium Human Reference 37 Supplementary_files_format_and_content: Wiggle files; read densities from PAR-CLIP experiments.
|
|
|
Submission date |
Apr 18, 2012 |
Last update date |
May 15, 2019 |
Contact name |
Andreas R Gruber |
E-mail(s) |
agruber@tbi.univie.ac.at
|
Organization name |
University of Basel
|
Department |
Biozentrum
|
Lab |
Zavolan
|
Street address |
Klingelbergstrasse 50-70
|
City |
Basel |
ZIP/Postal code |
4056 |
Country |
Switzerland |
|
|
Platform ID |
GPL9052 |
Series (2) |
GSE37398 |
Genome-wide analysis of pre-mRNA 3' end processing reveals a decisive role of human cleavage factor I in the regulation of 3' UTR length: CLIP |
GSE37401 |
Genome-wide analysis of pre-mRNA 3' end processing reveals a decisive role of human cleavage factor I in the regulation of 3' UTR length |
|
Relations |
SRA |
SRX143267 |
BioSample |
SAMN00858119 |