|
Status |
Public on Jun 01, 2012 |
Title |
PARCLIP_ZC3H7B |
Sample type |
SRA |
|
|
Source name |
HEK293 cell culture
|
Organism |
Homo sapiens |
Characteristics |
cell line: HEK293 cell line stably expressing: HIS/FLAG/HA-tagged ZC3H7B par-clip antibody: FLAG culture medium: DMEM
|
Treatment protocol |
HEK293 cells stably expressing His/FLAG/HA-tagged proteins of interest were grown in medium supplemented with 4-thiouridine at a final concentration of 200 microM for 16 hour. Cells were UV-crosslinked at 365 nm.
|
Growth protocol |
HEK293 cells were grown in D-MEM high glucose with 10% (v/v) fetal bovine serum, 1% (v/v) 2 mM L-glutamine, 1% (v/v) 10,000 U/ml penicillin/10,000 µg/ml streptomycin
|
Extracted molecule |
total RNA |
Extraction protocol |
PAR-CLIP and small RNA cloning (Hafner et al. 2010 Cell 141, 129–141)
|
|
|
Library strategy |
RNA-Seq |
Library source |
transcriptomic |
Library selection |
cDNA |
Instrument model |
Illumina HiSeq 2000 |
|
|
Description |
binding sites barcode for 1_qseq.txt: TCTCACGTCGTATGCCGTCTTCTGCTTG barcode for 2_qseq.txt: TCTCTGCTCGTATGCCGTCTTCTGCTTG
|
Data processing |
Adapters were removed with FAR 1.81 (the felxible adapter remover: http://sourceforge.net/projects/theflexibleadap/) aligned to hg18 and a set of RefSeq pre-mRNA sequences with BWA 0.5.8c. Unique alignments were converted to a pileup and read clusters scored for characteristic conversions and read variability with a custom script. After stringent-false positive filtering (using antisense clusters as a decoy database) remaining clusters were output as bed files. See Lebedeva et al. 2011 Mol Cell 43, 340–352 for details Genome_build: hg18 Supplementary_files_format_and_content: bed file reporting binding sites
|
|
|
Submission date |
May 24, 2012 |
Last update date |
May 15, 2019 |
Contact name |
Markus Landthaler |
E-mail(s) |
markus.landthaler@mdc-berlin.de
|
Phone |
+49-30-9406-3026
|
Organization name |
Max-Delbrück-Center for Molecular Medicine
|
Department |
Berlin Institute for Medical Systems Biology
|
Street address |
Robert-Rössle-Straße 10
|
City |
Berlin |
ZIP/Postal code |
13125 |
Country |
Germany |
|
|
Platform ID |
GPL11154 |
Series (2) |
GSE38157 |
The mRNA-bound proteome and its global occupancy profile on protein-coding transcripts |
GSE38201 |
The mRNA-bound proteome and its global occupancy profile on protein-coding transcripts [PAR-CLIP] |
|
Relations |
SRA |
SRX149421 |
BioSample |
SAMN00998312 |