|
Status |
Public on Jun 01, 2012 |
Title |
profiling library 2 |
Sample type |
SRA |
|
|
Source name |
HEK293 cell culture
|
Organism |
Homo sapiens |
Characteristics |
treatment: 4SU labeling and UV purification: oligo(dT) beads
|
Treatment protocol |
HEK293 cells stably were grown in medium supplemented with 4-thiouridine at a final concentration of 200 microM for 16 hour. Cells were UV-crosslinked at 365 nm.
|
Growth protocol |
HEK293 cells were grown in D-MEM high glucose with 10% (v/v) fetal bovine serum, 1% (v/v) 2 mM L-glutamine, 1% (v/v) 10,000 U/ml penicillin/10,000 µg/ml streptomycin
|
Extracted molecule |
total RNA |
Extraction protocol |
Hafner et al. Methods. 2008 Jan;44(1):3-12
|
|
|
Library strategy |
RNA-Seq |
Library source |
transcriptomic |
Library selection |
cDNA |
Instrument model |
Illumina HiSeq 2000 |
|
|
Description |
ProtOccProf library 2 Binding Profile barcode for Library2_1_qseq.txt: TCTCTGCTCGTATGCCGTCTTCTGCTTG barcode for Library2_2_qseq.txt: TCTCTGCTCGTATGCCGTCTTCTGCTTG barcode for Library2_3_qseq.txt: TCTCTGCTCGTATGCCGTCTTCTGCTTG
|
Data processing |
We used tophat (version 1.32) (Trapnell et al., 2009) for spliced alignment of single-end reads to the human reference genome sequence (hg18). Prior knowledge on candidate splice junctions was obtained from EnsEMBL (release 54, www.ensembl.org) to increase the sensitivity of the mapping process. We separated all reads by strand and generated two strand-specific mpileup file with samtools 0.1.18 (Li et al., 2009). These file were subsequently input into custom PERL scripts to produce a separate bedgraph file for each strand (Watson / Crick). Bedgraph files were loaded into our local UCSC hg18 genome browser instance for visualization purposes. Additionally, a single bedgraph file for strand-specific T to C conversions was produced in a similar manner. T to C conversion sites are only included in the final file if at least two conversion events were observed. Genome_build: hg18 Supplementary_files_format_and_content: bed file reporting consensus profiles
|
|
|
Submission date |
May 31, 2012 |
Last update date |
May 15, 2019 |
Contact name |
Markus Landthaler |
E-mail(s) |
markus.landthaler@mdc-berlin.de
|
Phone |
+49-30-9406-3026
|
Organization name |
Max-Delbrück-Center for Molecular Medicine
|
Department |
Berlin Institute for Medical Systems Biology
|
Street address |
Robert-Rössle-Straße 10
|
City |
Berlin |
ZIP/Postal code |
13125 |
Country |
Germany |
|
|
Platform ID |
GPL11154 |
Series (2) |
GSE38157 |
The mRNA-bound proteome and its global occupancy profile on protein-coding transcripts |
GSE38355 |
The mRNA-bound proteome and its global occupancy profile on protein-coding transcripts [protein occupancy profiling] |
|
Relations |
SRA |
SRX150805 |
BioSample |
SAMN01001253 |