|
Status |
Public on Oct 16, 2012 |
Title |
LNCaP Cells RNA-seq |
Sample type |
SRA |
|
|
Source name |
LNCaP
|
Organism |
Homo sapiens |
Characteristics |
cell line: LNCaP
|
Growth protocol |
Cells were grown at 37ºC with 5% CO2 in T medium with 10% fetal calf serum.
|
Extracted molecule |
total RNA |
Extraction protocol |
RNA was extracted from cell lines using Trizol reagent (Invitrogen) according to the manufacturer’s protocol and the integrity confirmed using an Agilent Bioanalyzer. To make a sequencing library, both Illumina mRNA-Seq Sample Prep Kit (#RS-100-0801) and Small RNA Sample Prep Kit Illumina (# FC-102-1009) were used.
|
|
|
Library strategy |
RNA-Seq |
Library source |
transcriptomic |
Library selection |
cDNA |
Instrument model |
Illumina Genome Analyzer IIx |
|
|
Description |
cDNA, first strand of synthesis
|
Data processing |
The adapter sequence ATCTCGTATGCCGTCTTCTGCTTG was removed with the program cutadapt. Reads were mapped with TopHat 1.2.0. Only uniquely mapping reads were allowed. The mapped reads were then assembled into transcripts with Cufflinks 1.1.0. Default parameters were kept, except that ENSEMBL release 54 for hg18 was used as a reference transcript annotation. Novel transcripts were not assembled. Genome_build: hg18 Supplementary_files_format_and_content: BigWig. Read coverage of genomic positions, per 1 million bases mapped.
|
|
|
Submission date |
Jun 13, 2012 |
Last update date |
May 15, 2019 |
Contact name |
Aaron Statham |
E-mail(s) |
a.statham@garvan.org.au
|
Organization name |
Garvan Institute of Medical Research
|
Department |
Cancer Department
|
Lab |
Epigenetics Research Laboratory
|
Street address |
384 Victoria St
|
City |
Darlinghurst |
State/province |
NSW |
ZIP/Postal code |
2010 |
Country |
Australia |
|
|
Platform ID |
GPL10999 |
Series (2) |
GSE38676 |
Expression Analysis of Normal and Cancerous Prostate Cells |
GSE38685 |
Normal and Cancerous Prostate Cells |
|
Relations |
SRA |
SRX154490 |
BioSample |
SAMN01048172 |