GEO Accession viewer

NCBI > GEO > Accession Display

Not logged in | Login

GEO help: Mouse over screen elements for information.

Sample GSM949619

Query DataSets for GSM949619

Status

Public on Mar 23, 2015

Title

RPC155_ChIP_BisSeq

Sample type

SRA

Source name

HeLa-S3

Organism

Homo sapiens

Characteristics

cell line: HeLa cervical carcinoma cells
chip antibody: RPC155 (serum 1900, Bob White lab)
starting library amount: 10ng

Growth protocol

All samples were from the same batch of cross-linked HeLa cells, grown to 75% confluence in T75 flasks with DMEM +10% (v/v) FBS, 10 mM glutamine in standard growth conditions. Cells were cross-linked in 1% formaldehyde for 30 minutes.

Extracted molecule

genomic DNA

Extraction protocol

Lysates were clarified from sonicated nuclei and protein-DNA complexes were isolated with antibody. About 20-40 x 10^6 cells were used per immunoprecipitation reaction. DNA was purified from protein-DNA complexes (10 ChIP reactions pooled) and ChIP-seq library was prepared using Illumina ChIP-seq library protocol with the addition of bisulfite conversion after addition of adapters but before amplification. In parallel, DNA was purified from nuclear sonicate and two input libraries were prepared: 1) starting with 10ng, using ChIP-seq library protocol with the addition of bisulfite conversion after addition of adapters but before amplification, and 2) standard Illumina Bisulfite DNA library protocol. All libraries included addition of 2% sheared Lambda DNA to control for bisulfite conversion. The Qiagen EpiTect kit was used for bisulfite conversion, with four periods of incubation at 60°C (for 25, 85, 175, and 120 min), each preceded by denaturation for 10 min at 98°C. Size selection was not performed for the amplified libraries (except the standard Input library) due to the small insert size, and the small amount of total library after amplification.

Library strategy

OTHER

Library source

genomic

Library selection

other

Instrument model

Illumina HiSeq 2000

Data processing

Library strategy: ChIP-seq protocol with additional bisulfite conversion step (ChIP-Bis-seq)
Basecalls performed using CASAVA version 1.7
Reads were aligned with Novoalign V2.07.09 using paired-end (-FILMFQ -t120 -h120 -b2 -a -i PE 20-600) or single-end settings (-FILMFQ -t120 -h120 -b2 -a). A Novoalign index was created for the hg18 genome (UCSC), plus the Lambda genome (Genbank accession number J02459.1) and adapter sequences (Illumina PE PCR Primer 2.0: CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT) with these options: novoindex -k 13 -s 3 -b. Repeat alignments intersecting at least one uniquely aligned sequence realigned using single-end settings, allowing up to 7 alignments (-r A 7), which includes 85% of the repeat reads. Reads from 8082X1_110523_SN141_0354_BB0236ABXX_3_1 were aligned as single-end as there were HiSeq issues with the second read; reads in 8082X1_110523_SN141_0354_BB0236ABXX_3_2 were not aligned.
The rates of conversion of methylated cytosines in the reads aligning to Lambda were 99.87% and 99.64% for input and pol III libraries, respectively, as determined by NovoalignBisulfiteParser (USeq package).
Analysis of aligned data was performed with the USeq package of programs (useq.sourceforce.net). For ChIP-seq analysis, alignments were converted to single-position point data with NovoalignParser (with no quality filter, to include repeat alignments) and peaks were called with ScanSeqs (using peakshift of 116bp, as determined by PeakShiftFinder, and 300bp window) and EnrichedRegionMaker with thresholds of 20 or 70, 13, and 1 for Q-value FDR, Empirical FDR, and log2 ratio, respectively. To obtain a list of enriched pol III-transcribed genes (including SINEs), pol III-enriched regions (Q-value 20 threshold) were intersected with an annotation file containing all SINEs, tRNA genes and fragments, and other pol III-transcribed genes and elements from the RepeatMasker track of UCSC. The annotated genes/repeat elements were scored by DefinedRegionScanSeqs using the PointData and Q-value 70 threshold was used. The number of enriched genes by class are 1472 Alu, 242 tRNA, 83 MIR, 7 U6, 4 hY, 3 7SL/SRP, 3 HVG, 2 rRNA, 2 miRNA, one RNaseP, one MRP, one BC200, and one 7SK to a total of 1822 genes.
For methylation analysis, alignments were converted to per-base methylated and unmethylated cytosines with NovoalignBisulfiteParser (with no quality filter to include repeat alignments). Regions statistically enriched or reduced for methylation were determined with BisSeq (using settings -w 10 -m 10 -f 13 -l 0). Percent methylation scores for enriched pol III target genes (including SINEs) was obtained using ScoreMethylatedRegions.
Genome_build: hg18
Supplementary_files_format_and_content: .xls file contains output of ChIP-seq and bisulfite sequencing analysis.

Submission date

Jun 18, 2012

Last update date

May 15, 2019

Contact name

Andrew J Oler

E-mail(s)

andrew.oler@nih.gov

Organization name

NIAID/NIH

Department

Bioinformatics and Computational Biosciences Branch (BCBB)