|
Status |
Public on Dec 13, 2012 |
Title |
I304N FLAG-HA FMR1 iso7 |
Sample type |
SRA |
|
|
Source name |
FlpIn T-Rex Human embryonic kidney 293 stable cell line
|
Organism |
Homo sapiens |
Characteristics |
cell line: FlpIn T-Rex Human embryonic kidney 293 stable cell line photoactivatable ribonucleoside and crosslinking wavelength: 4-SU / 365 nm antibody: anti-FLAG M2 [Sigma-Aldrich, cat# F1804, lot#101M6216] immunoprecipitated protein: I304N FLAG-HA FMR1 iso7
|
Treatment protocol |
Expression of stable transgenes were induced by incubation with 1 µg/ml doxycyline concurrent with 100 µM 4-Thiouridine (4SU, Sigma) for 16 h. For harvesting, cells were rinsed with ice-cold PBS, irradiated with 365 nM UV light (0.15 J/sq cm), collected and pelleted, and finally snap-frozen (-80 deg C)
|
Growth protocol |
FlpIn T-Rex HEK293 stable cell lines were cultured in DMEM (11995, Invitrogen) supplemented with 10% Fetal bovine serum, 2 mM L-Glutamine, 50 units of Penicillin, 50 µg/ml Streptomycin, 100 µg/ml Hygromycin, and 15 µg/ml Blasticidin
|
Extracted molecule |
total RNA |
Extraction protocol |
Cell pellets were lysed in NP40 lysis buffer, centrifuged, and the resulting supernatants used in subsequent steps. The cleared supernatants were incubated with Rnase T1 (Fermentas) at 22ºC, for 15 min, then cooled on ice. FLAG-antibody conjugate paramagnetic beads (Dynabeads, Invitrogen) were added to each supernatant to begin immunoprecipitation. Immunoprecipitates were subjected to dephosphorylation using calf-intestinal alkaline phosphatase (NEB), followed by three buffer washes, then treatment with T4 polynucleotide kinase (NEB) using gamma radiolabelled - 32P ATP. Radiolaballed immunoprecipitates were then fractionated by SDS-PAGE. The immunoprecipitated bands of interest were excised, electroeluted, and treated with Proteinase K to isolate crosslinked RNAs. Crosslinked RNAs were taken through a standard adapter-mediated small RNA cloning protocol and sequenced using Illumina GAII platform (or HiSeq).
|
|
|
Library strategy |
RNA-Seq |
Library source |
transcriptomic |
Library selection |
other |
Instrument model |
Illumina HiSeq 2000 |
|
|
Description |
PAR-CLIP iso7_I304N_1 I304N FMR1 iso7 crosslinked ribonucleoprotein complexes
|
Data processing |
Fastq was converted to fasta using FASTX Toolkit 0.0.13: fastq_to_fasta -v Adapters were removed using FASTX Toolkit: fastx_clipper -v -a TCGTATGCCGTCTTCTGCTTG -l 13 Reads were mapped to hg19 using bowtie version 0.12.7: bowtie bowtie/base/hg19 -v 2 -m 10 --all --best --strata Sites were determined using PARalyzer v1.1 Genome_build: hg19 Supplementary_files_format_and_content: bed files reporting target sites for RNA-binding proteins
|
|
|
Submission date |
Jul 26, 2012 |
Last update date |
May 15, 2019 |
Contact name |
Manuel Ascano, Jr. |
Organization name |
The Rockefeller University
|
Department |
HHMI/Laboratory of RNA Molecular Biology
|
Lab |
Tuschl Laboratory
|
Street address |
1230 York Avenue Box 186
|
City |
New York |
State/province |
NY |
ZIP/Postal code |
10021-6307 |
Country |
USA |
|
|
Platform ID |
GPL11154 |
Series (2) |
GSE39682 |
FMR1 targets distinct mRNA sequence elements to regulate protein expression [PAR-CLIP] |
GSE39686 |
FMR1 targets distinct mRNA sequence elements to regulate protein expression |
|
Relations |
SRA |
SRX171150 |
BioSample |
SAMN01095731 |