|
|
GEO help: Mouse over screen elements for information. |
|
Status |
Public on Oct 30, 2012 |
Title |
A-seq siRNA Control |
Sample type |
SRA |
|
|
Source name |
HEK293
|
Organism |
Homo sapiens |
Characteristics |
cell line: HEK293 sirna: scrambled-A fragmentation: alkaline hydrolysis
|
Treatment protocol |
For RNAi, HEK293 cells were seeded at a density of 20% in six well plates and all subsequent steps were done according to the "forward method" from the RNAiMAX protocol (Invitrogen). The next day, double stranded siRNAs were incubated with Lipofectamine RNAiMAX (Invitrogen) and added to the wells. After 3 days, cells were harvested and used for confirmation of the siRNA treatment by Western blot and for A-seq.
|
Growth protocol |
HEK293 cells were routinely grown in DMEM supplemented with 10% FCS in the presence of antibiotics.
|
Extracted molecule |
polyA RNA |
Extraction protocol |
A-seq protocol: A-seq starts with selection of the poly(A)-containing RNAs on oligo-(dT)25 Dynabeads, followed by partial digestion with RNase I that cleaves after any nucleotide or alkaline hydrolysis. The 5' ends are then phosphorylated, the 3' ends blocked by 3'dATP and an RNA primer is ligated to the 5' end of the RNA fragments. Our reverse transcription (RT) primer features an anchor nucleotide (A, C or G) designed to align to the first nucleotide upstream of the poly(A) tail, followed by six dTs that anneal to the first six nucleotides (nt) of the poly(A) tail. Following are a stem-loop containing the 3' adaptor sense strand (needed for priming the subsequent PCR reaction), its complement, and finally a stretch of 18 dTs, which together with the 6 dTs after the anchor nucleotide form a 24 nucleotide(nt)-long contiguous oligo dT stretch that aligns to the poly(A) tail. The products of RT and PCR are therefore expected to have 6 As preceding the 3' adaptor (AAAAAATGGAATTCTCGGGTGCCAAGG).
|
|
|
Library strategy |
RNA-Seq |
Library source |
transcriptomic |
Library selection |
cDNA |
Instrument model |
Illumina HiSeq 2000 |
|
|
Description |
3' adapter sequence: AAAAAATGGAATTCTCGGGTGCCAAGG
|
Data processing |
A-seq reads were pre-processed to remove the six diagnostic adenosines derived from the poly(A) tail as well as the 3' adaptor sequence and then were mapped to the human genome (hg19) and annotated using the CLIPZ server. For the construction of the set of 3' end cleavage sites, we only used reads that had the adaptor removed, mapped uniquely to genomic regions and whose annotation was "mRNA", "repeat", "miscRNA", or "unknown". Based on the precise mapping of the 3' ends of these reads we computed putative cleavage sites with their associated abundance. To minimize the frequency of internal priming sites in our data set, we discarded those that in the eight-nucleotide-region immediately downstream of the putative cleavage site had at least seven A nucleotides. The raw reads were processed on the CLIPZ server (http://http://www.clipz.unibas.ch; Khorshid et al., Nucleic Acids Research 2011, 39:D245). Genome_build: hg19, GRCh37 Genome Reference Consortium Human Reference 37 Supplementary_files_format_and_content: BED file containing inferred 3' ends
|
|
|
Submission date |
Aug 15, 2012 |
Last update date |
May 15, 2019 |
Contact name |
Andreas R Gruber |
E-mail(s) |
agruber@tbi.univie.ac.at
|
Organization name |
University of Basel
|
Department |
Biozentrum
|
Lab |
Zavolan
|
Street address |
Klingelbergstrasse 50-70
|
City |
Basel |
ZIP/Postal code |
4056 |
Country |
Switzerland |
|
|
Platform ID |
GPL11154 |
Series (1) |
GSE40137 |
Cleavage Factor Im as a key regulator of 3’ UTR length |
|
Relations |
SRA |
SRX176926 |
BioSample |
SAMN01120123 |
Supplementary file |
Size |
Download |
File type/resource |
GSM986134_315_1460_SIRNACTRL.bed.gz |
5.9 Mb |
(ftp)(http) |
BED |
SRA Run Selector |
Raw data are available in SRA |
Processed data provided as supplementary file |
|
|
|
|
|