NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM1006730 Query DataSets for GSM1006730
Status Public on Jan 02, 2013
Title GroSeq_1hr_1-2
Sample type SRA
 
Source name GRO-seq H1-hESC-1hr-Activin
Organism Homo sapiens
Characteristics cell type: H1 embryonic stem cells
chip antibody: BrdU
antibody catalog number: Santa Cruz 32323-ac
linker_sequence: TCGTATGCCGTCTTCTGCTTG
drug treatment: Activin
drug concentration: 50ng/ml
duration of treatment: 1hr
Growth protocol H1 cells were grown to confluence in mTESR1 media. Cells were then rested for 24 hours in RPMI-B27 and then treated with Activin 50ng/ml for 1 hour
Extracted molecule total RNA
Extraction protocol Nuclei were isolated from hESC and differentiating hESC. GRO-seq libraries were prepared from 5 million cells based on previously published protocols (Core et al., 2008). Libraries were sequenced on Illumina Hi-Seq 2000.
 
Library strategy OTHER
Library source transcriptomic
Library selection other
Instrument model Illumina HiSeq 2000
 
Description GroSeq_1hr_rep1-rep2
Data processing Library strategy: Gro-Seq
For all Gro_Seq samples, reads were first cut to 40bp, then trimmed to remover linker sequence. Reads shorter than 24bp after trimming were removed. The remaining reads were aligned to their indicated build using bowtie with parameters -e 70 -k 1 -m 10 -n 2 --best --strata, with the additional -l parameter set to the read lengths. See Manuscript for additional details.
supplementary_files_format_and_content: WIG files: For Gro-Seq samples, replicates were merged and combined aligned sequences were extended 10bp and allocated into 10bp bins. Reads from plus and minus strans were processed into separate tracks. Counts were normalized to reads per million, and bins with at least 0.1 read per million are shown.
Images analysis and base calling was done using the solexa pipeline.
Genome_build: hg18
 
Submission date Sep 19, 2012
Last update date May 15, 2019
Contact name Richard A Young
E-mail(s) young_computation@wi.mit.edu
Phone 617-258-5219
Organization name Whitehead Institute for Biomedical Research
Lab Young Lab
Street address 9 Cambridge Center
City Cambridge
State/province MA
ZIP/Postal code 02142
Country USA
 
Platform ID GPL11154
Series (1)
GSE41009 Divergent transcription of lncRNA/mRNA gene pairs in embryonic stem cells
Relations
Reanalyzed by GSE94418
SRA SRX188851
BioSample SAMN01179608

Supplementary file Size Download File type/resource
GSM1006730_Gro-Seq_1hr.WIG.gz 17.4 Mb (ftp)(http) WIG
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap