|
Status |
Public on Jan 02, 2013 |
Title |
GroSeq_48hr_1-2 |
Sample type |
SRA |
|
|
Source name |
GRO-seq H1-hESC-48hr-Activin
|
Organism |
Homo sapiens |
Characteristics |
cell type: H1 embryonic stem cells chip antibody: BrdU antibody catalog number: Santa Cruz 32323-ac linker_sequence: TCGTATGCCGTCTTCTGCTTG drug treatment: Activin drug concentration: 50ng/ml duration of treatment: 48hr
|
Growth protocol |
H1 cells were grown to confluence in mTESR1 media. Cells were then rested for 24 hours in RPMI-B27 and then treated with Activin 50ng/ml for 48 hours
|
Extracted molecule |
total RNA |
Extraction protocol |
Nuclei were isolated from hESC and differentiating hESC. GRO-seq libraries were prepared from 5 million cells based on previously published protocols (Core et al., 2008). Libraries were sequenced on Illumina Hi-Seq 2000.
|
|
|
Library strategy |
OTHER |
Library source |
transcriptomic |
Library selection |
other |
Instrument model |
Illumina HiSeq 2000 |
|
|
Description |
GroSeq_48hr_rep1-rep2
|
Data processing |
Library strategy: Gro-Seq For all Gro_Seq samples, reads were first cut to 40bp, then trimmed to remover linker sequence. Reads shorter than 24bp after trimming were removed. The remaining reads were aligned to their indicated build using bowtie with parameters -e 70 -k 1 -m 10 -n 2 --best --strata, with the additional -l parameter set to the read lengths. See Manuscript for additional details. supplementary_files_format_and_content: WIG files: For Gro-Seq samples, replicates were merged and combined aligned sequences were extended 10bp and allocated into 10bp bins. Reads from plus and minus strans were processed into separate tracks. Counts were normalized to reads per million, and bins with at least 0.1 read per million are shown. Images analysis and base calling was done using the solexa pipeline. Genome_build: hg18
|
|
|
Submission date |
Sep 19, 2012 |
Last update date |
May 15, 2019 |
Contact name |
Richard A Young |
E-mail(s) |
young_computation@wi.mit.edu
|
Phone |
617-258-5219
|
Organization name |
Whitehead Institute for Biomedical Research
|
Lab |
Young Lab
|
Street address |
9 Cambridge Center
|
City |
Cambridge |
State/province |
MA |
ZIP/Postal code |
02142 |
Country |
USA |
|
|
Platform ID |
GPL11154 |
Series (1) |
GSE41009 |
Divergent transcription of lncRNA/mRNA gene pairs in embryonic stem cells |
|
Relations |
Reanalyzed by |
GSE94418 |
SRA |
SRX188852 |
BioSample |
SAMN01179609 |