|
| Status |
Public on May 08, 2015 |
| Title |
WNT6_Control_hg19 |
| Sample type |
SRA |
| |
|
| Source name |
human adult fibroblasts
|
| Organism |
Homo sapiens |
| Characteristics |
tissue: fibroblasts
age: adult
genotype: control
1st restriction enzymes: BglII
2nd restriction enzymes: Csp6I
viewpoint: WNT6
|
| Treatment protocol |
Single cell suspension was generated using a Trypsin solution (0.05%).
|
| Growth protocol |
Skin fibroblasts were cultured in DMEM (Lonza) supplemented with 10% fetal calf serum (Gibco), 1% ultraglutamine (Lonza) and 1% penicillin/streptomycin (Lonza).
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
4C-seq libraries were generated from microdissected tissues or cells as described previously (van de Werken et al., 2012). BglII or HindIII (6-bp cutters) were used as primary restriction enzymes. Csp6I or DpnII were used as secondary restriction enzymes. For each viewpoint, a total of 1.6 mg of each library was amplified in 8 or 16 PCR reactions, depending on PCR efficiencies. Samples were multiplexed and sequenced with Ilumina Hi-Seq technology. The following primers were used: WNT6_promoter_forward: CTACACGACGCTCTTCCGATCTGCAGCACTCACTCTAGCC, WNT6_promoter_reverse: CAGACGTGTGCTCTTCCGATCTGTTCGGAACCCAGACAGT, IHH_promoter_forward: CTACACGACGCTCTTCCGATCTAGAGTTGTTGAAAGGGTTAAAA, IHH_promoter_reverse: CAGACGTGTGCTCTTCCGATCTCTTGTCTGGTTGTGGCTTAC, PAX3_promoter_forward: CTACACGACGCTCTTCCGATCTGATGAATGTTCAAACCCAGAT, PAX3_promoter_reverse: CAGACGTGTGCTCTTCCGATCTGCGTGGAGTCAGAAGGAGT
Samples were multiplexed and sequenced with Illumina Hi-Seq technology according to the manufacturer´s protocol.
|
| |
|
| Library strategy |
OTHER |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
Illumina HiSeq 1000 |
| |
|
| Data processing |
Library strategy: 4C-Seq
Reads were mapped by Novoalign (Novoalign V2.07; www.novocraft.com) to the reference sequences GRCh37/hg19.
To visualize the data, we created files in bedGraph track format for the readcounts of each fragment or in a specified window of fragments.
The viewpoint, adjacent undigested fragment and fragments 10 kb up and downstream were removed.
4C-seq contacts were analyzed in the human region chr2:217000000-225000000. A range of 5 fragments was used to normalize the data per million reads (RPM) over a sliding window and display the continuous-valued data in the figures. Log2 ratios were calculated by dividing fragment reads between different samples.
Genome_build: hg19
Supplementary_files_format_and_content: Smoothed/normalized data (bedGraph).
|
| |
|
| Submission date |
Feb 27, 2015 |
| Last update date |
May 15, 2019 |
| Contact name |
Darío G Lupiáñez |
| E-mail(s) |
lupianez@molgen.mpg.de
|
| Organization name |
Max Planck Institute for Molecular Genetics
|
| Street address |
Ihnestrasse 73
|
| City |
Berlin |
| ZIP/Postal code |
14195 |
| Country |
Germany |
| |
|
| Platform ID |
GPL15433 |
| Series (2) |
| GSE66378 |
Disruptions of Topological Chromatin Domains Causes Pathogenic Rewiring of Gene-Enhancer Interactions [4C-Seq-human] |
| GSE66383 |
Disruptions of Topological Chromatin Domains Causes Pathogenic Rewiring of Gene-Enhancer Interactions |
|
| Relations |
| BioSample |
SAMN03379899 |
| SRA |
SRX893595 |
