|
|
GEO help: Mouse over screen elements for information. |
|
Status |
Public on Apr 23, 2015 |
Title |
HB (Sample 24) |
Sample type |
SRA |
|
|
Source name |
Differentiated hindbrain cells from ES cells d14
|
Organism |
Homo sapiens |
Characteristics |
protocol: H9 cells were differentiated towards a hindbrain fate according to the protocol in Kirkeby et al 2012, Frontiers in Cellular Neuroscience. cell line: H9 cell type: Differentiated hindbrain cells from ES cells d14
|
Treatment protocol |
Kirkeby A, Grealish S, Wolf DA, Nelander J, Wood J, Lundblad M, Lindvall O, Parmar M. Generation of regionally specified neural progenitors and functional neurons from human embryonic stem cells under defined conditions. Cell Rep. 2012 Jun 28;1(6):703-14. doi: 10.1016/j.celrep.2012.04.009. Epub 2012 May 26.
|
Growth protocol |
Kirkeby A, Nelander J, Parmar M. Generating regionalized neuronal cells from pluripotency, a step-by-step protocol. Front Cell Neurosci. 2013 Jan 3;6:64. doi: 10.3389/fncel.2012.00064
|
Extracted molecule |
total RNA |
Extraction protocol |
RNA was exracted using the miRNeasy mini kit form Qiagen
|
|
|
Library strategy |
miRNA-Seq |
Library source |
transcriptomic |
Library selection |
size fractionation |
Instrument model |
Illumina HiSeq 2500 |
|
|
Data processing |
Mature and hairpin microRNAs were downladed from mirbase.org 2013-06-22 Preprocessing with fastx, http://hannonlab.cshl.edu/fastx_toolkit/index.html The adapter TGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC was removed Sequences shorter than 15 nt were removed. A fasta file with read counts was produced for each sample Bowtie2 was used for alignment. Reference : Langmead B, Trapnell C, Pop M, Salzberg SL. Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biol 10:R25. Bowtie indices were built using the mature and hairpin files from mirbase. Alignment was performed for the reads of each sample. Default bowtie2 scores were used For each sample and micro-RNA, the total count was found. The counts were multiplicatively normalized such that each sample had the same total count. The counts were logarithm tansformed by adding a pseudocount of 1 to all counts and taking the base 2 logarithm. Genome_build: Mirbase release 19 Supplementary_files_format_and_content: csv file with normalized counts for the microRNAs for each sample
|
|
|
Submission date |
Apr 23, 2015 |
Last update date |
May 15, 2019 |
Contact name |
Malin Parmar |
Organization name |
Lund University
|
Department |
Wallenberg Neuroscience Center
|
Street address |
BMC A11
|
City |
Lund |
ZIP/Postal code |
22184 |
Country |
Sweden |
|
|
Platform ID |
GPL16791 |
Series (1) |
GSE68189 |
Comprehensive analysis of microRNA expression in the human developing brain reveals microRNA-10 as a caudalizing factor |
|
Relations |
BioSample |
SAMN03565576 |
SRA |
SRX1005626 |
Supplementary data files not provided |
SRA Run Selector |
Raw data are available in SRA |
Processed data are available on Series record |
|
|
|
|
|