|
|
GEO help: Mouse over screen elements for information. |
|
Status |
Public on Feb 14, 2016 |
Title |
T47D control batch7 RP |
Sample type |
SRA |
|
|
Source name |
T47D cell line
|
Organism |
Homo sapiens |
Characteristics |
cell line: T47D
|
Treatment protocol |
For starvation experiments, cells were culture for 48hrs in glutamine-free DMEM (Life Technologies) supplemented with 10% dialyzed FBS in 5% CO2 at 37°C.
|
Growth protocol |
All breast cancer cell lines were grown in DMEM supplemented with 10% FBS in 5% CO2 at 37°C.
|
Extracted molecule |
total RNA |
Extraction protocol |
Approximately 30e6 cells were treated with chloramphenicol (100μg/ml) for 15 minutes and cycloheximide (100μg/ml) for 5 minutes. Cells were lysed in buffer B (20 mM Tris-HCl, pH 7.8, 100mM KCl, 10mM MgCl2, 1% Triton X-100, 2mM DTT, 100 μg/ml chloramphenicol, 100 μg/ml cycloheximide, 1x Complete protease inhibitor). Lysates were centrifuged at 5000 rpm and the supernatant was treated with 2U/μl of RNase I (Ambion) for 40 minutes at room temperature. Lysates were fractionated on a linear sucrose gradient (7% - 47%) using the SW- 41Ti rotor at 36,000 rpm for 2hrs. Fractions enriched in mito-monosomes and cytosolic monosomes were identified by western blotting, pooled and treated with proteinase K (Roche) in 1% SDS. Released RPFs were purified using Trizol reagent (Invitrogen) following the manufacturer’s instructions. RNA was gel-purified on a denaturing 10% polyacrylamide urea (7 M) gel. A section corresponding to 30-33 nucleotides was excised, eluted and ethanol precipitated. The resulting fragments were 3′-dephosphorylated using T4 polynucleotide kinase (New England Biolabs Inc. Beverly, MA, USA) for 6 h at 37°C in 2-(N-morpholino)ethanesulfonic acid (MES) buffer (100 mM MES-NaOH, pH 5.5, 10 mM MgCl2, 10 mM β-mercaptoethanol, 300 mM NaCl). 3′ adaptor was added with T4 RNA ligase 1 (New England Biolabs Inc. Beverly, MA, USA) for 2.5 h at 37°C. Ligation products were 5′-phosphorylated with T4 polynucleotide kinase for 30 min at 37°C. 5′ adaptor was added with T4 RNA ligase 1 for 18 h at 22°C.
|
|
|
Library strategy |
OTHER |
Library source |
transcriptomic |
Library selection |
other |
Instrument model |
Illumina HiSeq 2000 |
|
|
Description |
ribosome profiling adapter sequence (3'): TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG
|
Data processing |
Adapter sequences were trimmed from raw data using cutadapt 1.1 with parameters (--quality-base=33 -O 12 -m 20 -q 5). Reads without adapter sequence were discarded. rRNA was filtered from data by alignment to transcript database compiled from Ensembl 37.65 (gene categories “rRNA”, “rRNA_pseudogene” and “Mt_rRNA”) using bowtie (v2.0.6) with parameters (--seed 42 --local) and retention of the unmapped reads. Analogous to rRNA filtering, tRNA was filtered by alignment to a tRNA database compiled from the GtRNAdb (Chan and Lowe, NAR, 2009). Reads not mapped in previous steps were used in final alignment using tophat (v2.0.7) with parameters (--seed 42 -n 2 -m 1 --no-novel-juncs --no-novel-indels --no-coverage-search --segment-length 25) to hg19 and transcripts defined by GENCODE v19/BASIC. Genome_build: hg19 Supplementary_files_format_and_content: WIG files were generated from alignment files output by tophat in the final alignment step, only using primary alignments and alignments with mapping quality >= 10. Scores indicate read coverage, normalized to reads per 10 million reads.
|
|
|
Submission date |
Jun 16, 2015 |
Last update date |
May 15, 2019 |
Contact name |
Koos Rooijers |
E-mail(s) |
k.rooijers@nki.nl
|
Organization name |
Netherlands Cancer Institute
|
Department |
Gene Regulation
|
Lab |
Agami Lab
|
Street address |
Plesmanlaan 121
|
City |
Amsterdam |
ZIP/Postal code |
1066CX |
Country |
Netherlands |
|
|
Platform ID |
GPL11154 |
Series (2) |
GSE59821 |
Restrictions in amino acid availability revealed by differential ribosome codon reading |
GSE69923 |
Ribosome profiling on glutamine-starved panel of luminal and basal breast cancer cell lines |
|
Relations |
BioSample |
SAMN03776766 |
SRA |
SRX1059912 |
Supplementary file |
Size |
Download |
File type/resource |
GSM1712844_T47D_control_batch7_RP.normalized.minus.wig.gz |
5.3 Mb |
(ftp)(http) |
WIG |
GSM1712844_T47D_control_batch7_RP.normalized.plus.wig.gz |
5.5 Mb |
(ftp)(http) |
WIG |
SRA Run Selector |
Raw data are available in SRA |
Processed data provided as supplementary file |
|
|
|
|
|