 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Feb 14, 2016 |
| Title |
SUM159PT in vivo 1 repl2 RP |
| Sample type |
SRA |
| |
|
| Source name |
SUM159PT
|
| Organism |
Homo sapiens |
| Characteristics |
adapter sequence (3'): TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG
cell line: SUM159PT
|
| Growth protocol |
SUM159PT cells were cultured in DMEM/F12 1:1 medium supplemented with 5% FBS, insulin (5μg/ml), and hydrocortisone (1μg/ml).
|
| Extracted molecule |
total RNA |
| Extraction protocol |
SUM-159 GFP-RPL10a cells were treated with cycloheximide at a final conc of 10ug/m for 5 min. Cells were washed with cold PBS, scraped, and pelleted. Cell pellet was lysed with 1ml of NP40 lysis buffer (20mM Tris-HCl pH 7.8, 10mM MgCl2, 150mM KCl, 1% NP40, 2 mM DTT, 1X Complete protease Inhibitors, 100 ug/ml CHX) for 15 min, centrifuged for 10 min at 1300 g and 1ml of supernatant recovered. For tumors preparation, each tumor was lysed in 1ml of NP40 lysis buffer in a tissue homogenizer. Tumor lysate was centrifuged at 1300g for 10 min and the supernatant was incubated with the beads. 85 ul per condition of GFP-Trap_M beads (Chromotek) were washed for 3 times in 1ml of NP40 lysis buffer, resuspended in 3 ml of NP40 lysis buffer. 1ml of cleared lysate (cell line or tumor) was added to the beads and digested with RNAse I (100U/ul) for 1hr at RT under constant rotation. Beads were washed 3 times with of NP40 Lysis buffer and 3 times with NP40 wash buffer (20mM Tris-HCl pH 7.8, 10mM MgCl2, 350mM KCl, 1% NP40, 2 mM DTT, 1X Complete protease Inhibitors, 100 ug/ml CHX). Beads were resuspended in 300 ul of lysis buffer with 1% SDS and 15 ul of Proteinase K (Roche) and incubated for 1hr at 45C. Supernatant was recovered and resuspended in TriSure. RNA was isolated and libraries prepared according to the RP protocol.
RNA was gel-purified on a denaturing 10% polyacrylamide urea (7 M) gel. A section corresponding to 30-33 nucleotides was excised, eluted and ethanol precipitated. The resulting fragments were 3′-dephosphorylated using T4 polynucleotide kinase (New England Biolabs Inc. Beverly, MA, USA) for 6 h at 37°C in 2-(N-morpholino)ethanesulfonic acid (MES) buffer (100 mM MES-NaOH, pH 5.5, 10 mM MgCl2, 10 mM β-mercaptoethanol, 300 mM NaCl). 3′ adaptor was added with T4 RNA ligase 1 (New England Biolabs Inc. Beverly, MA, USA) for 2.5 h at 37°C. Ligation products were 5′-phosphorylated with T4 polynucleotide kinase for 30 min at 37°C. 5′ adaptor was added with T4 RNA ligase 1 for 18 h at 22°C.
|
| |
|
| Library strategy |
OTHER |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina HiSeq 2500 |
| |
|
| Description |
Ribosome profiling
|
| Data processing |
Adapter sequences were trimmed from raw data using cutadapt 1.1 with parameters (--quality-base=33 -O 12 -m 20 -q 5). Reads without adapter sequence were discarded.
rRNA was filtered from data by alignment to transcript database compiled from Ensembl 37.65 (gene categories “rRNA”, “rRNA_pseudogene” and “Mt_rRNA”) using bowtie (v2.0.6) with parameters (--seed 42 --local) and retention of the unmapped reads.
Analogous to rRNA filtering, tRNA was filtered by alignment to a tRNA database compiled from the GtRNAdb (Chan and Lowe, NAR, 2009).
Reads not mapped in previous steps were used in final alignment using tophat (v2.0.7) with parameters (--seed 42 -n 2 -m 1 --no-novel-juncs --no-novel-indels --no-coverage-search --segment-length 25) to hg19 and transcripts defined by GENCODE v19/BASIC.
Genome_build: hg19
Supplementary_files_format_and_content: WIG files were generated from alignment files output by tophat in the final alignment step, only using primary alignments and alignments with mapping quality >= 10. Scores indicate read coverage, normalized to reads per 10 million reads.
|
| |
|
| Submission date |
Oct 30, 2015 |
| Last update date |
May 15, 2019 |
| Contact name |
Koos Rooijers |
| E-mail(s) |
k.rooijers@nki.nl
|
| Organization name |
Netherlands Cancer Institute
|
| Department |
Gene Regulation
|
| Lab |
Agami Lab
|
| Street address |
Plesmanlaan 121
|
| City |
Amsterdam |
| ZIP/Postal code |
1066CX |
| Country |
Netherlands |
| |
|
| Platform ID |
GPL16791 |
| Series (2) |
| GSE59821 |
Restrictions in amino acid availability revealed by differential ribosome codon reading |
| GSE74512 |
Ribosome profiling on SUM159PT cells grown in vitro or in vivo |
|
| Relations |
| BioSample |
SAMN04226658 |
| SRA |
SRX1402299 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM1922003_SUM159PT_in_vivo_1_repl2_RP.normalized.minus.wig.gz |
13.3 Mb |
(ftp)(http) |
WIG |
| GSM1922003_SUM159PT_in_vivo_1_repl2_RP.normalized.plus.wig.gz |
13.8 Mb |
(ftp)(http) |
WIG |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
