|
Status |
Public on Jul 11, 2016 |
Title |
Control plasmid transfection for the PUM1/2 OE 2 |
Sample type |
SRA |
|
|
Source name |
U2OS cells
|
Organism |
Homo sapiens |
Characteristics |
cell line: U2OS sample treatment: Control siRNA
|
Treatment protocol |
Plasmid transfections were performed using PolyEthylene Imine (PEI)35 (PEI linear, Mr 25000 from Polyscience Inc). In order to overexpress NORAD, the full transcript of the lincRNA was amplified from human genomic DNA (ATCC NCI-BL2126) using the primers TGCCAGCGCAGAGAACTGCC (Fw) and GGCACTCGGGAGTGTCAGGTTC (Rev), and cloned into a ZeroBlunt TOPO vector (Invitrogen), and then subcloned into the pcDNA3.1(+) vector (Invitrogen). PUM1 and PUM2 were over-expressed using pEF-BOS vectors34 (a kind gift of Prof. Takashi Fujita). As controls in over-expression experiments we used pBluescript II KS+ (Stratagene). Plasmids were used in the amount of 0.1µg per 100,000 cells in 24 well plates for 24 h before cells were harvested. Gene knockdown was achieved using siRNAs directed against NORAD, PUM1, and PUM2 genes (all from Dharmacon, Supplementary Table 1), while as control we used the mammalian non-targeting siRNA (Lincode Non-targeting Pool, Dharmacon), at final concentration of 50nM for 24h or 48h prior to further experimental procedures. The transfections into U2OS cells were conducted using the PolyEthylene Imine. siRNA transfection into HeLa cells were conducted using 100 nM siRNA and Dharmafect (Dharmacon) transfection reagent and using siRNA buffer only as a control, and transfection of pCDNA3.1-NORAD was into HeLa cells was peformed using Lipofectamine 2000.
|
Growth protocol |
Human cell lines U2OS (osteosarcoma) and HeLa (cervical carcinoma) were routinely cultured in DMEM containing 10% fetal bovine serum and 100 U penicillin / 0.1 mg/ml streptomycin at 37 °C in a humidified incubator with 5% CO2.
|
Extracted molecule |
polyA RNA |
Extraction protocol |
Total RNA was isolated using TRI reagent (MRC) Strand-specific mRNA-seq libraries were prepared from U2OS cells using the TruSeq Stranded mRNA Library Prep Kit (Illumina). Strand-specific mRNA-seq libraries for HeLa cells were prepared as described in Guo et al. Nature 2010.
|
|
|
Library strategy |
RNA-Seq |
Library source |
transcriptomic |
Library selection |
cDNA |
Instrument model |
Illumina NextSeq 500 |
|
|
Data processing |
Reads were aligned to the human genome (hg19 assembly) using STAR Aligner Read counts for individual genes (defined as overlapping sets of RefSeq transcripts annotated with their Entrez Gene identifier) were counted using htseq-count Genome_build: hg19 Supplementary_files_format_and_content: Counts for individual genes (Entrez Gene, and where not available, RefSeq identifiers)
|
|
|
Submission date |
Mar 31, 2016 |
Last update date |
May 15, 2019 |
Contact name |
Igor Ulitsky |
E-mail(s) |
igor.ulitsky@weizmann.ac.il
|
Organization name |
Weizmann Institute of Science
|
Street address |
Hertzl St.
|
City |
Rehovot |
ZIP/Postal code |
76100 |
Country |
Israel |
|
|
Platform ID |
GPL18573 |
Series (1) |
GSE79804 |
A conserved abundant cytoplasmic long noncoding RNA modulates repression of mRNAs by Pumilio proteins in human cells |
|
Relations |
BioSample |
SAMN04595268 |
SRA |
SRX1672213 |