|
| Status |
Public on Feb 17, 2017 |
| Title |
SIRT7 RIP RNA, cytosol rep2 |
| Sample type |
SRA |
| |
|
| Source name |
HEK 293T stably overexpressing Flag-SIRT7
|
| Organism |
Homo sapiens |
| Characteristics |
cell line: HEK 293T
overexpression construct: Flag-SIRT7
passages: 10~15
|
| Growth protocol |
HEK293T cells stably overexpressing Flag-tagged SIRT7 were cultured in DMEM supplemented with 10% FBS (fetal bovine serum) and penicillin-streptomycin
|
| Extracted molecule |
total RNA |
| Extraction protocol |
For the extraction of total SIRT7-RIP RNA, we first fractionated cell lysates into cytosolic and nuclear fractions and then performed RIP (RNA immunoprecipitation) experiment. Briefly, the lysates were incubated with anti-Flag M2 affinity gel to immunoprecipitate SIRT7 ribonucleoprotein complex (RNP) . Anti-Flag beads were washed extensively and then subjected to proteinase K digestion to release RNA from SIRT7 RNP. RNA associated with SIRT7 was then extracted by standard phenol-chloroform extraction followed with ethanol precipitation.
Directional RNA-seq libraries were prepared from 25-100ng input RNA using the NEBNext Ultra Directional RNA Library Prep Kit for Illumina (New England Biolabs).
|
| |
|
| Library strategy |
RIP-Seq |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Description |
SIRT7-RIP RNA, cytosolic fraction
|
| Data processing |
Illumina pipeline software v1.8 was used for base calling.
cutadapt v1.5 (-m 20 -q 20 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTC --match-read-wildcards) was used to trim and filter reads.
bowtie2 v2.2.6 (default params) was used to map reads matching human rRNA genes (45S, 5S, MT 12S, MT 16S).
samtools mpileup v1.3 was used to compile coverage counts per nucleotide for rRNA genes
Genome_build: NR_046235.1 (45S), NR_023363.1 (5S), NC_012920.1: gi|251831106:1671-3229 (MT 16S), gi|251831106:648-1601 (MT 12S)
Supplementary_files_format_and_content: samtools mpileup counts per position for rRNA genes (txt file)
|
| |
|
| Submission date |
May 24, 2016 |
| Last update date |
May 15, 2019 |
| Contact name |
Jennifer K Grenier |
| Organization name |
Cornell University
|
| Department |
Biomedical Sciences
|
| Lab |
Biotechnology Building rm 333
|
| Street address |
526 Campus Rd
|
| City |
Ithaca |
| State/province |
NY |
| ZIP/Postal code |
14853 |
| Country |
USA |
| |
|
| Platform ID |
GPL18573 |
| Series (2) |
| GSE81839 |
SIRT7 is an RNA-activated protein lysine deacylase [RIP ribosomal RNA] |
| GSE81841 |
SIRT7 is an RNA-activated protein lysine deacylase |
|
| Relations |
| BioSample |
SAMN05172296 |
| SRA |
SRX1798515 |
