|
|
GEO help: Mouse over screen elements for information. |
|
Status |
Public on Apr 27, 2017 |
Title |
RH4 MYOD1 promoter 4C |
Sample type |
SRA |
|
|
Source name |
Fusion Positive RMS cell line
|
Organism |
Homo sapiens |
Characteristics |
cell line: RH4 cell type: rhabdomyosarcoma 4c viewpoint: MYOD1 promoter viewpoint primers for inverse pcr: F: GGGATTCCTAACCTGGGCAG viewpoint primers for inverse pcr: R: AGTTGGATGCTGTGTCCCG
|
Treatment protocol |
Briefly, fixed cells were exposed to 4-bp cutter DpnII for the primary restriction enzyme, re-ligated in dilute conditions, followed by reversal of crosslinks and purification. Csp6I was used to reduce template to sizes amenable to inverse PCR for viewpoint amplification.
|
Growth protocol |
Cell lines were grown in DMEM supplemented with 10%FBS and Pen/Strep.
|
Extracted molecule |
genomic DNA |
Extraction protocol |
DNA was enriched from cut and religated genomic DNA samples using inverse PCR with primers designed using standard protocols developed previously [Splinter, E., de Wit, E., van de Werken, H.J.G., Klous, P., and de Laat, W. (2012). Determining long-range chromatin interactions for selected genomic sites using 4C-seq technology: From fixation to computation. Methods 58, 221-230.]. Standard Illumina barcodes were introduced during library preparation
|
|
|
Library strategy |
OTHER |
Library source |
genomic |
Library selection |
other |
Instrument model |
Illumina NextSeq 500 |
|
|
Description |
DNA (Chromatin Conformation Capture Enriched)
|
Data processing |
Library strategy: 4C-seq 4C reads were checked to confirm they contained the appropriate viewpoint (from bait primer sequence). Reads were discarded if no viewpoint sequence was found, allowing up to one mismatch. For matched reads, the barcode and viewpoint sequence were trimmed prior to mapping. Processed reads were then aligned (hg19). Reads mapping to the viewpoint, self-ligated products and 4 kb surrounding the viewpoint were removed (Lupiáñez et al., 2015), and a coverage density map with window size of 1 kb was created. For visualization, this coverage density map was smoothed by taking an average of read count within 5 windows downstream and upstream, and visualized in IGV with normalized reads per million mapped reads. Genome_build: Hg19 Supplementary_files_format_and_content: bedgraph of processed 4C data
|
|
|
Submission date |
Jun 26, 2016 |
Last update date |
May 15, 2019 |
Contact name |
Javed Khan |
E-mail(s) |
khanjav@mail.nih.gov
|
Phone |
2407606135
|
Organization name |
NCI, NIH
|
Department |
Genetics Branch
|
Lab |
Javed Khan
|
Street address |
37 Convent Dr.
|
City |
Bethesda |
State/province |
MD |
ZIP/Postal code |
20892 |
Country |
USA |
|
|
Platform ID |
GPL18573 |
Series (2) |
GSE83727 |
Chromatin looping evidence between PAX3-FOXO1 bound super enhancer and MYOD1 promoter [4C-seq] |
GSE83728 |
Epigenetic Lanscape and BRD4 Transcriptional Dependency of PAX3-FOXO1 Driven Rhabdomyosarcoma |
|
Relations |
BioSample |
SAMN05293557 |
SRA |
SRX1878873 |
Supplementary file |
Size |
Download |
File type/resource |
GSM2214146_Sample_RH4_MYOD_SE1_4C_H7WKVBGXX_2_Both.1000.dup.smoothed.w5.w3.tdf.bedgraph.gz |
420.3 Kb |
(ftp)(http) |
BEDGRAPH |
SRA Run Selector |
Raw data are available in SRA |
Processed data provided as supplementary file |
|
|
|
|
|