 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Aug 02, 2016 |
| Title |
H7_D2LtM_ATAC-seq |
| Sample type |
SRA |
| |
|
| Source name |
H7 ESC
|
| Organism |
Homo sapiens |
| Characteristics |
source: H7 ESC
sample type: H7 human embryonic stem cells derived day 2 Lateral Mesoderm (D2LtM) cells
|
| Treatment protocol |
H7-derived day 1 mid primitive streak was briefly washed (DMEM/F12) and differentiated towards day 2 lateral mesoderm for 24 hours (1 μM A-83-01 + 30 ng/mL BMP4 + 1 μM C59) in CDM2 basal medium.
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
Total RNA or chromatin was extracted as described below
Bulk RNA-seq: Total RNA from flow-sorted or differentiated cell populations was isolated using Trizol (ThermoFisher) as per manufacturer’s recommendation and was facilitated by addition of linear polyacrylamide (Sigma) as a carrier during RNA precipitation. Purified total RNA was treated with 4 units of RQ1 RNase-free DNase (Promega) at 37 dgrees Celsius for 1 hour to remove trace amounts of genomic DNA. The DNase-treated total RNA was cleaned-up using RNeasy micro kit (QIAGEN). Subsequently, the integrity of extracted RNA was assayed by on-chip electrophoresis (Agilent Bioanalyzer) and only samples with a high RNA integrity (RIN) value were used for subsequent cDNA preparation. Purified total RNA (10-50 ng) was reverse-transcribed into cDNA and amplified using the Ovation RNA-seq System V2 (NuGEN). Amplified cDNA was sheared using the Covaris S2 (Covaris) using the following settings: total volume 120 l, duty cycle 10%, intensity 5, cycle/burst 100, total time 2 min. The sheared cDNA was cleaned up using Agencourt Ampure XP (Beckman Coulter) to obtain cDNA fragments >= 400 base pairs (bp). 500 ng of sheared and size-selected cDNA were used as input for library preparation using NEBNext Ultra DNA Library Prep Kit for Illumina (New England BioLabs) as per manufacturer’s recommendations. Resulting libraries (fragment distribution: 300-700 bp; peak 500-550 bp) were pooled (multiplexing) and sequenced using HiSeq 4000 or NextSeq 500 (Illumina) at the Stanford Functional Genomics Facility to obtain 2x150 base pair paired-end reads. For each RNA-seq library, the effectiveness of adapter ligation and the effective library concentration was determined by qPCR and bioanalyzer (Agilent) prior to pooling and loading them onto the sequencers. The reads obtained were trimmed for base call quality (PHRED score >= 21) and the presence of adapter sequences at the 3' end using Skewer (version: 0.1.127; Jiang et al, BMC Bioinformatics, 2014). Single-cell RNA-seq: Cells were briefly washed (DMEM/F12), dissociated (TrypLE Express), strained (100 micron filter), pelleted and resuspended in DMEM/F12 for counting. Before single-cell capture, two quality control steps were implemented. Firstly, cell size was estimated in order to determine whether cells should be loaded onto C1 capture arrays of either 10-17 micron or 17-25 micron size. Arrays were chosen for each lineage by estimating the median cell size of each given population on a flow cytometer on the basis of the FSC-W signal and choosing an array with an appropriate pore size to accommodate such cells. Secondly, to ensure the high viability of in vitro-differentiated cells prior to commencing single-cell RNA-seq, for each population a separate aliquot of cells was stained with 1.1 micromolar DAPI and analyzed by flow cytometry; for all cell populations that were used for single-cell RNA-seq, 98% of cells were viable (i.e., DAPI negative). For single-cell capture, cells were diluted to a concentration of 1000 cells/microliter, diluted 3:2 in C1 Cell Suspension Reagent, and loaded onto a Fluidigm C1 single-cell capture array chip for automated capture on a Fluidigm C1 Machine (Stanford Stem Cell Institute single-cell Core). After loading, the efficiency of single-cell capture was verified using an automated microscope that imaged each catured cell on the chip. The subsequent cell lysis, cDNA synthesis, and aplification was carried on the array chip inside the microfuidic chamber in an automated fashion using C1 machine using the SMARTer Ultra Low RNA Kit (Clontech, 634833) reagents as per the manufacturers' instructions (Fluidigm, PN 100-7168 Rev. A2). The amplified cDNA from individual cells was harvested into a 96 well and diluted using the harvesting reagent (Fluidigm). The concentration and integrity of amplified cDNA were assessed using a Fragment Analyzer (Advanced Analytical) in a 96 well plate format. Amplified cDNAs form only thos wells that (1) were not degraded, and (2) originated from wells that were microscopically verified to contain a single cell, were carried forward for subsequent library construction. Using a single-channel liquid handeling robot, Mosquito (TTP Labtech), amplified cDNAs from single-cells from all the lineages were diluted to a concentration range of 0.05-0.16 ng/microliter using C1 Harvest Reagent (Fluidigm) as a diluent and consolidated into 384 well plates. The diluted single-cell cDNAs were tagmented and converted to sequencing libraries in the 384 well plates using the Nextera XT DNA Sample Prep Kit (Illumina, FC-131-1096) in an automated fashion using another 16-channel Moquito robot (TTP Labtech) and 384 distinct illumina compatiblr molecular barcodes. The resulting sequencing libraies from a single such 384 plate were then pooled and cleaned up using Agencourt AMPure XP beads (Beckman Coulter). The pooled libraries were then analyzed for quality and concentration using bioanalyzer (Agilent) and qPCR and loaded on a single lane of NextSeq 500 or two lanes of Hiseq 4000 to obtain 1-2 million 2x150 reads per cell. The reads obtained were trimmed for base call quality (PHRED score >= 21) and the presence of adapter sequences using Skewer (version: 0.1.127; Jiang et al, BMC Bioinformatics, 2014). ATAC-seq: For each replicate, 50,000 cells were lysed in lysis buffer containing 0.01% IGEPAL CA-630 (Sigma, I8896) to obtain nuclei, which were directly used in the Tn5 transposition reaction (reagents from Nextera DNA Sample Preparation Kit; Illumina, FC-121-1030). Immediately following transposition, DNA fragments were purified (MinElute Kit, Qiagen) and PCR amplified for a total of 12-13 cycles using previously-designed primer sequences that include illumina compatible adapters and barcodes. The resulting ATAC-seq libraries were purified (MinElute Kit, Qiagen), pooled and final library-pool concentrations were assessed (Bioanalyzer) prior to next-generation sequencing. The quality of ATAC-seq libraries was confirmed by a shallow sequencing run using a MiSeq v3 (Stanford Functional Genomics Facility, 2x75bp reads) before deep sequencing was performed on a NextSeq 500 (2x75bp reads).
|
| |
|
| Library strategy |
OTHER |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Description |
This files contain peaks that were reproducible between the two replicates for each cell type, in standard narrowPeak format.
|
| Data processing |
Sequenced reads were trimmed for adaptor sequences using skewer 0.1.127 with parameters -x AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG -y AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT -t 16 -q 21 -l 21 -n -u -f sanger for bulk-population RNA-seq and parameters -x CTGTCTCTTATACACATCTCCGAGCCCACGAGACNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG -y CTGTCTCTTATACACATCTGACGCTGCCGACGANNNNNNNNGTGTAGATCTCGGTGGTCGCCGTATCATT -t 16 -q 21 -l 21 -n -u -f sanger for single-cell RNA-seq.
Trimmed reads were then mapped to hg38 using STAR 2.4 with parameters --outSAMunmapped Within --outFilterType BySJout --outSAMattributes NH HI AS NM MD --outFilterMultimapNmax 20 --outFilterMismatchNmax 999 --outFilterMismatchNoverReadLmax 0.04 --alignIntronMin 20 --alignIntronMax 1000000 --alignMatesGapMax 1000000 --alignSJoverhangMin 8 --alignSJDBoverhangMin 1 --sjdbScore 1 --twopassMode Basic --twopass1readsN -1 --outWigStrand Stranded
Normalized expression values (TPM) and transcript counts were then calculated using RSEM 1.2.21 with parameters --bam --estimate-rspd --seed 12345 --paired-end --forward-prob 0
Genome_build: hg38
|
| |
|
| Submission date |
Aug 01, 2016 |
| Last update date |
May 15, 2019 |
| Contact name |
Rahul Sinha |
| E-mail(s) |
rsinha76@gmail.com
|
| Organization name |
Stanford University School of Medicine
|
| Department |
ISCBRM
|
| Lab |
Weissman
|
| Street address |
265 Campus Drive
|
| City |
Stanford |
| State/province |
CA |
| ZIP/Postal code |
94305 |
| Country |
USA |
| |
|
| Platform ID |
GPL18573 |
| Series (1) |
| GSE85066 |
In vitro cultured H7 human embryonic stem cells (WiCell) and H7-derived downstream early mesoderm progenitors |
|
| Relations |
| BioSample |
SAMN04900908 |
| SRA |
SRX1960053 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM2257298_ATAC9+10_IDR.narrowPeak.gz |
1.6 Mb |
(ftp)(http) |
NARROWPEAK |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
| Processed data are available on Series record |
|
|
|
|
 |
