|
Status |
Public on May 01, 2018 |
Title |
ChIPSeq_scsiRNA_2 |
Sample type |
SRA |
|
|
Source name |
HeLa Cells
|
Organism |
Homo sapiens |
Characteristics |
cell line: HeLa replicate: Replicate 2 treatment: scrambled siRNA
|
Treatment protocol |
siRNA transfections performed using Lipofectamine RNAimax (Thermo Fisher).
|
Growth protocol |
HeLa cells grown in DMEM 10% FCS at 37 degree celsius and 5% CO2
|
Extracted molecule |
genomic DNA |
Extraction protocol |
RNA extracted using Trizol. ChIP-Seq performed as in Varshney et al, Nat. Comms, 2015 CLIP libraries prepared as in Huppertz et al, Methods, 2014 with a modified 3' RNA linker (3'-UGGAAUUCUCGGGUGCCAAGG-5'). RNASeq libraries were prepared according to Illumina's TruSeq Stranded Total RNA with Ribo-Zero Gold for Human/Mouse/Rat (RS-122-2303). ChIP-Seq libraries prepared as in Wiechens et al, PLoS genetics, 2016.
|
|
|
Library strategy |
ChIP-Seq |
Library source |
genomic |
Library selection |
ChIP |
Instrument model |
Illumina NextSeq 500 |
|
|
Description |
36 hours post treatment ChIPSeq_scsiRNA.bigWig
|
Data processing |
Base calling performed using the BCL2Fastq2 CLIP data was preprocessed by CIMS pipeline as in Moore et at, Nat. Protocols, 2014. Briefly, 3' adapter (TGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC) was trimmed and PCR duplicates collapsed. 5nt barcode at the 5' end was stripped and appended to the tag name CLIP data was aligned using novoaligm with 85 as the maximum alignment score acceptable for the best alignment, step size of 1 and read length of 20. RNASeq and ChIPSeq reads were aligned using STAR 2.5.1b. Number of CLIP aligned per transcript were counted using htseq-count with Gencode v24 annotation. RNASeq reads were quantified using -quantmode GeneCounts for genome indexed with Gencode v24 annotation. Number of ChIP aligned per gene locus were counted using htseq-count with Gencode v24 annotation. Differential expression analysis performed using edgeR Bioconductor package. ChIPSeq pileups were obtained from pooled alignment files using macs2 pileup utility. Genome_build: hg38 Supplementary_files_format_and_content: CLIP processed data contains raw counts from htseq-count. RNASeq processed data contains raw counts output from STAR 2.5.1b -quantmode GeneCounts per ensembl gene id. ChIP processed data contains macs2 pileup output from pooled alignment files.
|
|
|
Submission date |
Oct 07, 2016 |
Last update date |
May 15, 2019 |
Contact name |
Dhaval Varshney |
E-mail(s) |
d.varshney@dundee.ac.uk
|
Organization name |
University of Dundee
|
Department |
Centre for Gene Regulation and Expression
|
Street address |
Dow Street
|
City |
Dundee |
ZIP/Postal code |
DD1 5EH |
Country |
United Kingdom |
|
|
Platform ID |
GPL18573 |
Series (1) |
GSE87767 |
mRNA cap methyltransferase, RNMT-RAM, promotes RNA pol II transcription |
|
Relations |
BioSample |
SAMN05890493 |
SRA |
SRX2233741 |