|
Status |
Public on Dec 04, 2018 |
Title |
Group L, Cow 1, pre |
Sample type |
SRA |
|
|
Source name |
Group L_pre_venous blood PBMC
|
Organism |
Bos taurus |
Characteristics |
breed: dairy cows sample group: Group L age: Adult lactation stage: 21 days prepartum cell type: Peripheral blood mononuclear cells (PBMC)
|
Treatment protocol |
NA
|
Growth protocol |
standard dairy cow housing
|
Extracted molecule |
total RNA |
Extraction protocol |
Peripheral blood mononuclear cells (PBMC) were separated from veinous blood by Ficoll density gradient. Total RNA was isolated with Trizol, with an extra chloroform extraction to remove residual phenol and addition of glyco-blue as a carrier to promote RNA precipitation. Diretional RNA-seq libraries were prepared from 500ng total RNA using the NEBNext Directional Ultra II RNA Library Prep Kit for Illumina (New England Biolabs), with initial polyA+ isolation.
|
|
|
Library strategy |
RNA-Seq |
Library source |
transcriptomic |
Library selection |
cDNA |
Instrument model |
Illumina NextSeq 500 |
|
|
Description |
L1pre processed data file: PreVPost_gene_exp.diff: m21_3 4groups_gene_exp.diff: Lm21_0 genes.read_group_tracking: Lm21_0
|
Data processing |
Illumina pipeline software v1.8 was used for base calling. cutadapt v1.8 (-m 50 -q 20 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTC --match-read-wildcards) was used to trim and filter reads. tophat v2.1.1 (--no-novel-juncs --library-type fr-firststrand) was used to map reads to the Bos taurus UMD3.1 reference genome+transcriptome (Ensembl). cuffquant (--library-type fr-firststrand) was used to quantify transcripts based on the Bos taurus UMD3.1 reference genome+transcriptome (Ensembl). cuffdiff v2.2.1 was used to call differentially expressed genes based on the Bos taurus UMD3.1 reference genome+transcriptome (Ensembl). Genome_build: Bos taurus UMD3.1 (Ensembl) Supplementary_files_format_and_content: Tab delimited text files are standard cuffdiff2 output files for gene-level analysis, including counts, FPKM values, and q-values for differential expression testing (corrected for multiple hypothesis testing). The '*gene_exp.diff' files contain average FPKM values for each set of replicates as well as results for statistical testing for differential expression (PreVPost = all prepartum vs all postpartum samples; 4groups = H1-3pre vs H1-3post vs L1-3pre vs L1-3post). The 'genes.read_group_tracking' file contains raw mapped read counts and FPKM values for individual samples.
|
|
|
Submission date |
Aug 03, 2018 |
Last update date |
Dec 04, 2018 |
Contact name |
Jennifer K Grenier |
Organization name |
Cornell University
|
Department |
Biomedical Sciences
|
Lab |
Biotechnology Building rm 333
|
Street address |
526 Campus Rd
|
City |
Ithaca |
State/province |
NY |
ZIP/Postal code |
14853 |
Country |
USA |
|
|
Platform ID |
GPL23055 |
Series (1) |
GSE118108 |
Gene expression profiling of PBMCs in dairy cows pre- and post-partum |
|
Relations |
BioSample |
SAMN09764775 |
SRA |
SRX4506608 |