 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Sep 28, 2012 |
| Title |
Vector IP small RNA rep1 |
| Sample type |
SRA |
| |
|
| Source name |
flowers stage 1-12
|
| Organism |
Arabidopsis thaliana |
| Characteristics |
genetic background: Columbia
transgene: pMDC99-GUS (Vector)
molecule: small RNA
sample type: Vector IP
tissue: flower
developmental stage: stages 1-12
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Ten μl (or 100%) of the immunoprecipitated RNA was mixed with 15 pmol of Cloning Linker 1 (IDT), and incubated at 70ºC for 2 min. The mixture was cooled on ice for 2 min before adding 1.5 µl of 10X T4 RNA Ligase Reaction Buffer (NEB), 40 units of RNaseOUT (Invitrogen) and 10 units of T4 RNA Ligase 2 truncated K227Q (NEB). Ligation reactions were incubated overnight at 16ºC. Digestion of unligated Cloning Linker 1 was done by first adding 20 units of deadenylase (NEB) to the overnight ligation, and incubating at 30ºC for 15 min, then adding 10 units of Exonuclease VII (Affymetrix), and incubating at 37ºC for 15 min. Next, 15 pmol of RNA 5' adapter (GUUCAGAGUUCUACAGUCCGACGAUC) was denatured at 70ºC for 2 min followed by transfer to ice for at least 2 min. Denatured RNA 5’ adapter was added to the ligation mixture with 0.48 mM of ATP and 5 units of T4 RNA Ligase 1 (Ambion), and the resulting mixture was incubated at 28ºC for 1 h, then placed on ice. For cDNA synthesis, 5 µM of RT-Primer (ATTGATGGTGCCTACAG) was used with the SuperScript III First-Strand Synthesis System (Invitrogen). After cooling the cDNA synthesis reactions on ice, 2 units of E. coli RNase H (Invitrogen) were added, and the reaction was incubated at 37ºC for 20 min. Linear PCR reactions were done with half of the cDNA and in the presence of 1x Phusion HF Buffer, 0.25 µM of P5 primer (AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA), 0.25 µM of P7-modban (CAAGCAGAAGACGGCATACGAATTGATGGTGCCTACAG), 0.1 mM dNTP mix and 1 unit of Phusion Polymerase (Thermo Scientific). The following PCR conditions were used: 98ºC for 30 sec, 17 cycles of 98ºC for 10 sec, 60ºC for 30 sec, 72ºC for 15 sec; 72ºC for 5 min. The Qiagen PCR Purification Kit was used to clean up the PCR products before loading samples onto a 6% native polyacrylamide gel. The desired amplicons (between ~100-108 bp) were recovered from the gel using electro-transfer onto DE81 paper as previously described (Fahlgren et al., RNA 2009). DNA concentrations were quantified using the Qubit HS Assay Kit (Invitrogen) and submitted for sequencing on a HiSeq 2000 sequencer (Illumina).
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
Illumina HiSeq 2000 |
| |
|
| Description |
Small RNA isolated from immunoprecipitation control
|
| Data processing |
Sequencing reads from small RNA libraries were computationally processed to remove 3’ adaptor sequences, and sequences were consolidated to generate read counts per unique small RNA. Unique small RNAs were mapped to the A. thaliana genome (TAIR10) using Bowtie v0.12.8 (Langmead et al., Genome Biology 2009) with settings allowing for perfect matches only (bowtie –f –v 0 –a –S –p 10). Libraries were normalized for sequencing depth differences by randomly sampling genome-mapped small RNA read counts from each library to match the proportion of mapped reads from the smallest library, relative to the larger libraries, resulting in ~20 million reads per sample.
Genome_build: Arabidopsis thaliana Chr1-5, TAIR version 10
Supplementary_files_format_and_content: GFF (version 3) files are provided that contain small RNA mapping data and read abundances for the normalized datasets used in our study. GFF formats are specified in the header of each file.
|
| |
|
| Submission date |
Aug 21, 2012 |
| Last update date |
May 15, 2019 |
| Contact name |
James C Carrington |
| E-mail(s) |
jcarrington@danforthcenter.org
|
| Phone |
314-587-1202
|
| Organization name |
Donald Danforth Plant Science Center
|
| Lab |
James C. Carrington
|
| Street address |
975 North Warson Road
|
| City |
Saint Louis |
| State/province |
MO |
| ZIP/Postal code |
63132 |
| Country |
USA |
| |
|
| Platform ID |
GPL13222 |
| Series (2) |
| GSE40258 |
Functional analysis of Arabidopsis ARGONAUTE1 using a slicer-defective mutant: Small RNA immunoprecipitation |
| GSE40259 |
Functional analysis of Arabidopsis ARGONAUTE1 using a slicer-defective mutant |
|
| Relations |
| SRA |
SRX180053 |
| BioSample |
SAMN02079135 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM989350_vector_ip_smallRNA.gff3.gz |
8.4 Mb |
(ftp)(http) |
GFF3 |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
