GEO Accession viewer

NCBI > GEO > Accession Display

Not logged in | Login

GEO help: Mouse over screen elements for information.

Platform GPL13912

Query DataSets for GPL13912

Status

Public on Jul 13, 2011

Title

Agilent-028005 SurePrint G3 Mouse GE 8x60K Microarray (Feature Number version)

Technology type

in situ oligonucleotide

Distribution

custom-commercial

Organism

Mus musculus

Manufacturer

Agilent Technologies

Manufacture protocol

See manufacturer's web site (http://www.agilent.com/).

Description

Design ID: 028005
Build version: mm9:NCBI37:Jul2007

Arrays of this design have barcodes that begin with 16028005 or 2528005.

Orientation:
Features are numbered numbered Left-to-Right, Top-to-Bottom as scanned by an Agilent scanner (barcode on the left, DNA on the back surface, scanned through the glass), matching the FeatureNum output from Agilent's Feature Extraction software.

The ID column represents the Agilent Feature Extraction feature number.

Rows and columns are numbered as scanned by an Axon Scanner (barcode on the bottom, DNA on the front surface).

To match data scanned on an Axon scanner, use the RefNumber column contained in the Agilent-provided GAL file as the ID_REF column in sample submissions.

*** A different version of this platform with the Agilent Probe names in the ID column is assigned accession number GPL10787.

Submission date

Jul 13, 2011

Last update date

Jul 19, 2017

Organization

Agilent Technologies

E-mail(s)

cag_sales-na@agilent.com

Phone

877-424-4536

URL

http://www.agilent.com

Department

Street address

City

Palo Alto

State/province

ZIP/Postal code

94304

Country

USA

Samples (5679)

More...

GSM759882, GSM759929, GSM759930, GSM759931, GSM759932, GSM759933

Series (473)

More...

GSE30642	Mouse Macrophage Cells: Control vs. Burkholderia pseudomallei infected cells
GSE30647	Role of miR-125b in B-cell acute lymphoblastic leukemia (B-ALL)
GSE31731	Gene expression profile of HCCs developed in miR-122 knockout mice compared to age-matched wild type mice

GSE31822	Comparison of the gene expression profiles between iPS-OSH, iPS-J, ESC and MEF.
GSE32568	Gene expression comparison of wild-type and IL15ko thymic NKT cells
GSE34626	Adenosine deaminases that act on RNA induce reproducible changes in abundance and sequence of embryonic miRNAs
GSE34814	mRNA reponse to bleomycin instillation
GSE34818	MiR-199a-5p determines fibroblast activation and pulmonary fibrogenesis
GSE35215	Lack of hepatic response of microRNA in mice following DB[a,h]A exposure (Agilent expression)
GSE35509	Lack of hepatic response of microRNA in mice following DB[a,h]A exposure
GSE35653	Direct reprogramming of fibroblasts into embryonic Sertoli-like cells by defined factors
GSE36289	Comparison of the gene expression profiles between MEF, MEF treated with n-Butylenephthalide (BP) 10 and 40ug/ml.
GSE36313	DNA Methylation Restricts Lineage-Specific Functions of Transcription Factor Gata4 during Embryonic Stem Cell Differentiation
GSE36371	Expression data from mouse wild type, PRDM14-overexpressing and Dnmts KO embryonic stem cells (ESCs).
GSE36663	Expression profiles in the complete absence of DNA methylation [Agilent-028005]
GSE36702	Complete absence of DNA methylation effect on histone modifications H3K4me2, H3K27me3 and H3K9me2
GSE37825	Adrenal gene expression profiles of male and female Kcnk3 null mice in basal conditions or after hormonal treatment.
GSE37887	Cardiac gene expression (random section containing both ventricles) in C57BL/6 mice intratracheally instilled with Printex 90 carbon black nanoparticles (set 2)
GSE37891	Cardiac gene and miRNA expression (random section containing both ventricles) in C57BL/6 mice intratracheally instilled with Printex 90 carbon black nanoparticles
GSE38052	Genome-wide transcriptional effects of Pregnancy-Induced Non-coding RNA (PINC)
GSE38085	Gene expression profiles of EpiSCs under epiblastic and neural plate developmental conditions
GSE38096	Murine Testes: Germ Cell-Specific Sin3a Knockout vs. Hemizygous vs. Wild Type at Postnatal Day 0
GSE38968	Gene expression profiling in liver from control versus mutant Sox17 SHIVA fasted C57BL/6 mice
GSE38995	Juvenile postnatally overfed mice heart microarray anaylsis
GSE39648	Gene expression comparison between different stages of endogenous Sertoli cells and induced embryonic Sertoli cells derived from MEFs and TTFs
GSE39649	Comparison of gene expression between MEFs, MEFs (NWD), immature Sertoli cells and mature Sertoli cells
GSE39650	Comparison of gene expression between MEFs and induced embryonic Sertoli-like cells
GSE39662	RUNX1 reshapes the epigenetic landscape at the onset of hematopoiesis
GSE40289	Gene expression in the wildtype and top2b-deleted cardiomyocytes with or without doxorubicin treatment
GSE40577	The RNA-binding protein FXR1P regulates cell-cycle progression by modulating the expression of p21/cdkn1a/Cip1/Waf in myoblasts
GSE40990	Preparation of archival formalin-fixed paraffin-embedded mouse liver samples for use with the Agilent gene expression microarray platform
GSE41162	Lymphoid progenitor gene expression in Notch1 activated Gfi1-deleted cells
GSE41496	Toll-like receptor 7 is a primary sensor of malaria infection
GSE42052	Analysis of conditional loss of Geminin in neural tube and paraxial tissues at E10.5 by laser capture microdissection
GSE42330	Gene expression analysis of cultured adipocytes treated with different types of asbestos fibers
GSE42666	Expression data from Tet2-hypomorph (knockdown) and/or Ezh2-null Lineage-Sca-1+c-Kit+ (LSK) cells and granulocyte-macrophage progenitors (GMPs)
GSE43077	T-cell intracellular antigen (TIA) proteins deficiency in murine embryonic fibroblasts alters cell cycle progression and induces autophagy
GSE43670	The 3’UTR of FMR1 mRNA is a target of miR101, miR129-5p and miR-221: implications for the molecular pathology of FXTAS at the synapse.
GSE43764	Protective efficacy of orally administered, heat-killed Lactobacillus pentosus b240 against influenza A virus
GSE44109	Actinonin induced changes in gene expression profiles in MEFs
GSE45173	Reprogramming by Sall4, Nanog, Esrrb and Lin28 produces high quality iPSCs with a molecular signature of developmental potency that resembles ESCs.
GSE45191	Comparison of Hob6-Venus positive and negative Flk-1+ cells (Venus reporter)
GSE45192	Comparison of Hob6-RFP positive and negative Flk-1+ cells (RFP reporter)
GSE45193	Hob6 positive and negative cells
GSE45230	Transcriptoma analysis of B splenocytes of 3'RR-deficient mice and wt mice
GSE45299	Genes affected by Satb1 deficiency in HSC, LMPP and CLP
GSE45413	Effect of a DP1 agonist BW245C on concanavalin A-induced hepatitis
GSE45561	Gene expression analyses of hematopoietic stem cell (HSC) subsets in wildtype or CD41-KO mice
GSE45673	FoxO1 Controls Effector to Memory Transition and Maintenance of Functional CD8 T-Cell Memory
GSE45991	Amino acid deprivation due to overexpression of UCP1 in skeletal muscle: signalling via FGF-21
GSE45993	The effects of ectopic UCP1 expression on gene expression in skeletal muscle
GSE46321	C/EBPα poises B cells for rapid reprogramming into iPS cells [array]
GSE46437	Neutrophils promote M2 polarization of macrophages during Nippostrongylus brasiliensis infection
GSE46470	Biological events associated with 99mTcO4--mediated thyroid stunning effect
GSE46731	gene expression profile of CBZ treated mice
GSE47518	Identification of s-RNYs targets in bone marrow-derived macrophages
GSE47609	Atherogenic Stimuli Trigger Ago2-hnRNP A1-Dependent Processing of RNYs Regulating Apoptosis and Inflammatory Response in Macrophages
GSE47783	Transcriptional profiling of macrophage plasticity following recovery from Lipopolysaccharide (LPS) tolerance
GSE48014	Gene expression in the liver, effect of maternal high-fat diet during or prior to pregnancy
GSE48188	Mi2ß knockdown in ß-estradiol-treated (24 h) G1E-ER-GATA-1 cells
GSE48473	Gene expression at skin wound sites of WT and FoxO1+/- mice
GSE48946	Gene expression of non-apoptotic pancreatic acinar cell death with autophagy
GSE49174	SetD8 Knockdown in ß-estradiol-treated (24 h) G1E-ER-GATA-1 cells
GSE49332	Gene expression analysis in macrophages stimulated 18 h with Adiponectin
GSE49616	Gestational high salt stressed new born BdkrB2 knockout collecting duct cells vs BdkrB2 wild type collecting duct cells
GSE49867	Gene expression analysis of prefrontal cortex in mice exposed to chronic mild stress
GSE49876	Liver differentially expressed genes between microsomic and control inbred mice at birth
GSE50003	Gene Expression Profiling for Plk2 -/- mammary gland
GSE50176	Inhalation of rod-like carbon nanotubes causes unconventional asthma
GSE50432	Gene expression in the spleen; effect of maternal exposure to carbon black nanoparticle
GSE50531	Cardiogenic genes expressed in cardiac fibroblasts contribute to heart development and repair
GSE50542	Network Analysis Reveals a Novel Role for the AP-1 Transcription Factor JUNB in Classical and Alternative Macrophage Activation
GSE50742	Effect of miR-144 and miR-451 expression on lung epithelial cell responses to influenza infection at 1 and 18 hours.
GSE50910	Gene expression of thymic settling progenitors from embryos at E13 compared to E18
GSE51054	Gene expression profiles of E8.5, E9.5 and E11.5 kidney precursors
GSE51055	Divergent Compensatory Responses to High Fat Diet Between C57BL6/J and C57BLKs/J Inbred Mouse Strains
GSE51098	Gene expression of the intermediate and outer interzone of murine embryos at 15.5 days of gestation
GSE51222	Gene expression analysis in the lungs of Fra-2 Transgenic mice
GSE51227	Murine Abdominal Aortic Aneurysm, PPE Model: Transcriptional Profiling of Sham vs. AAA at Day 7
GSE51228	Murine Abdominal Aortic Aneurysm, PPE Model - In Vivo Modulation of miRNA-24 (Day 7)
GSE51229	Transcriptional profiling of murine porcine-pancreatic elastase-induced abdominal aortic aneurysm at day 7, with parallel miRNA profiling and miR-24 in vivo modulation.
GSE51343	Quercetin decreases high-fat diet induced bodyweight gain and accumulation of hepatic and circulating lipids in mice.
GSE51665	Role of Lamtor1 and mTOR in the polarization of M2 macrophages.
GSE51807	The gene expression analysis of the spinal cord and skeletal muscle of SBMA (Spinal Bulbar Muscular Atrophy) model mice with or without pioglitazone (PG) treatment
GSE51877	Identifying an Apical Ectodermal Ridge (AER) signature in embryonic day 11.5 mouse forelimb.
GSE52254	Transcription factor GATA1 is dispensable for mast cell differentiation in adult mice
GSE52397	C/EBPα poises B cells for rapid reprogramming into iPS cells
GSE52497	A crucial role of the ubiquitously expressed transcription factor Sp1 at early stages of hematopoietic specification [array]
GSE52499	A crucial role of the ubiquitously expressed transcription factor Sp1 at early stages of hematopoietic specification
GSE52675	Sox4 regulates proliferation, differentiation, and DNA methylation patterns in the intestinal epithelium
GSE52682	Large scale transcriptomic characterization of mice lung inflammation during Acute Lung Injury (lung)
GSE52683	Large scale transcriptomic characterization of mice brain inflammation during Acute Lung Injury (brain)
GSE52684	Large scale transcriptomic characterization of mice blood inflammation during Acute Lung Injury (PBMC)
GSE52685	Large scale transcriptomic characterization of mice blood inflammation during Acute Lung Injury
GSE52866	Gene expression signatures in heart tissues of mice simulating posttraumatic stress disorder (PTSD) [Study1]
GSE52871	Gene expression signatures in heart tissues of mice simulating posttraumatic stress disorder (PTSD) [Study2]
GSE52875	Expression signatures in heart tissues of mice simulating posttraumatic stress disorder (PTSD)
GSE52920	The PDZ-binding motif of SARS-CoV envelope protein is a determinant of viral pathogenesis
GSE53541	Zrf1 is required to establish and maintain neural progenitor identity (mRNA array)
GSE53542	Zrf1 is required to establish and maintain neural progenitor identity
GSE53724	Geriatric muscle stem cells switch reversible quiescence into senescence (Set 1; Geriatric vs. Young)
GSE53725	Geriatric muscle stem cells switch reversible quiescence into senescence (Set 2; Old/Geriatric vs. Young and SAMR1 vs. SAMP8)
GSE53726	Geriatric muscle stem cells switch reversible quiescence into senescence (Set 3; Adult vs. Young)
GSE53727	Geriatric muscle stem cells switch reversible quiescence into senescence (Set 4; Bmi1-deficient)
GSE53728	Geriatric muscle stem cells switch reversible quiescence into senescence
GSE53802	Hypoxia-induced metabolic dysfunction in WAT
GSE53803	DFO-induced hypoxia leading to metabolic dysfunction in WAT
GSE53804	Temperature-flux induced metabolic adjustments in WAT
GSE53805	External factors inducing metabolic adaptations in white adipose tissue in wildtype C57BL/6J mice housed at thermoneutrality.
GSE53973	ATF3 is a novel regulator of mouse neutrophil migration.
GSE54051	A Cbx8-containing Polycomb complex facilitates gene activation during ES cell differentiation [Agilent Array]
GSE54053	A Cbx8-containing Polycomb complex facilitates gene activation during ES cell differentiation
GSE54062	The role of Ch25h in the macrophage response to poly(I:C) (bone-marrow-derived macrophages)
GSE54063	The role of Ch25h in the macrophage response to poly(I:C) (Let1a)
GSE54064	The role of Ch25h in the macrophage response to poly(I:C)
GSE54234	CDH1 knockout in mice
GSE54311	shRNA Screening Identifies JMJD1C as being required for Leukemia Maintenance (Agilent)
GSE54591	Gene expression analysis of reprogrammed pancreatic cells, liver and pancreas
GSE54679	Alternatively activated macrophages derived from monocytes and tissue macrophages are phenotypically and functionally distinct
GSE55254	Microarray analysis of the testis from the aromatase overexpression transgenic and WT mice
GSE55646	Genes affected by SFRP5 overexpression in LSK cells and CLP
GSE56067	Epidermal RelA specifically restricts contact allergen-induced inflammation and apoptosis in skin
GSE56302	Induction of regulatory M2 macrophage-like immunosuppressive cells from mouse ES cells that contribute to prolong allogeneic immune rejection
GSE56391	wnt1-induced mammary tumor from Rarb KO mice vs. those from Rarb wt (control)
GSE56653	Gene expression profile in the lung of mice during pneumococcal pneumonia: WT vs NLRP3 inflammasome component-deficient mice
GSE56926	Deregulated expression of cytoskeleton related genes in the spinal cord and sciatic nerve of presymptomatic SOD1G93A Amyotrophic Lateral Sclerosis mouse model
GSE57055	Human hepatocytes support the hypertrophic but not the hyperplastic response to the murine nongenotoxic hepatocarcinogen sodium phenobarbital in an in vivo study using a chimeric mouse with humanized liver [Mouse Liver Experiments]
GSE57058	Human hepatocytes support the hypertrophic but not the hyperplastic response to the murine nongenotoxic hepatocarcinogen sodium phenobarbital in an in vivo study using a chimeric mouse with humanized liver
GSE57064	Macrophage Precursor Cells from the Left Atrial Appendage of the Adult Heart Spontaneously Reprogram into a C-kit+/CD45- Stem Cell-Like Phenotype [Array analysis]
GSE57126	Macrophage Precursor Cells from the Left Atrial Appendage of the Adult Heart Spontaneously Reprogram into a C-kit+/CD45- Stem Cell-Like Phenotype
GSE57355	The effect of type-I interferon signaling directly on CD8+ T cells following LCMV infection in the presence or absence of NK cells.
GSE57504	Pyruvate kinase M1 and M2 isoform knock in ES cells differentiate into three germ layers
GSE57572	Mechanisms of protection of a novel murine cytomegalovirus vaccine vector against Mycobacterium tuberculosis
GSE57772	A regulatory CD9+ B cell subset controls HDM-induced allergic airway inflammation
GSE57985	Gene transcript alterations exhibited in luminal and basal epithelial compartments with impaired Ror2 signaling
GSE58158	Digit patterning is controlled by a Bmp-Sox9-Wnt Turing network modulated by morphogen gradients
GSE58515	Gene expression of Bone marrow-derived macrophages isolated in ERR-alpha knock-out mice
GSE58627	Gene expression profiles of mouse embryonic stem cells (mESCs) after genetic depletion of Id1 and knock-down of Zrf1
GSE58756	Cell intrinsic expression of TLR9 in autoreactive B cells constrains BCR/TLR7-dependent responses
GSE58819	Trichloroethylene-induced mRNA expression changes in B6C3F1 mouse liver
GSE59024	Expression profile of BCR-ABL1-transformed, Cdk4 R24C, Cdk6 R31C cell lines
GSE59042	Expression profiling of microRNA and mRNA on hepatic inflammation in high-fat induced murine model
GSE59185	Host responses contributing to the attenuation of severe acute respiratory syndrome coronaviruses missing E protein domains
GSE59362	Comparative Analysis of Neonatal versus Adult Brain in Unilateral Brain Injury Mice Model Revealing Genes Involved in High Compensatory Motor Functional Recovery Mechanism
GSE59387	Expression data from wild-type control and Dnmt3a knockout osteoclast
GSE59425	The organoid generated from murine small intestine: mCherry-positive vs. mCherry-negative
GSE59755	Expression data from mouse embryonic stem cells across a time course of Erk stimulation
GSE60136	Exosc8-Regulated Genes in Fetal Liver-Derived Erythroid Progenitor Cells
GSE60137	Foxo3 Regulated Genes in G1E-ER-GATA-1 Cells
GSE60651	Gene expression alteration in chondrocyte by A-CEBP overexpression.
GSE60737	Gene expression alteration in chondrocyte by HES1 overexpression
GSE60931	The Mitochondrial Calcium Uniporter controls skeletal muscle mass in vivo
GSE61152	Gene expression profile after Dax1 deletion in ES cells
GSE61305	Expression profile of control, Drosha or Dicer deleted LSKs
GSE61318	Overlapping DNA methylation dynamics in mouse intestinal cell differentiation and early stages of malignant progression
GSE61409	The transcription repressors Bach2 and Bach1 promote B cell development by repressing the myeloid program
GSE61787	Gene expression profiles in the heart tissues of heart-specific Bmal1 knockout mice
GSE62267	Genotoxic, epigenetic, and transcriptomic effects of tamoxifen in mouse liver
GSE62362	Interstrain differences in the severity of liver injury induced by a choline- and folate-deficient diet in mice are associated with dysregulation of genes involved in lipid metabolism.
GSE62379	Chromatin decondensation is sufficient to alter nuclear organization in embryonic stem cells
GSE62594	Cerebellar oxidative DNA damage and altered DNA methylation in the BTBR T+tf/J mouse model of autism and similarities with human post mortem cerebellum.
GSE63136	Deconstruction of DNA methylation patterns during myogenesis reveals Myf5 super-enhancer hypomethylation in the establishment of the muscle lineage
GSE63227	Quercetin showed no genotoxicity by transcriptomic analysis in liver and small intestine of mice
GSE63247	Knockout of Vdac1 activates the HIF signaling pathway and induces tumor development in vivo by promoting vascular remodeling and inflammation
GSE63574	Overexpression of the Growth arrest specific 1 (Gas1) gene reduces the in vivo progression of murine hepatocellular carcinoma and restores gene expression level
GSE63702	The NFKB inducing kinase (NIK) modulates hematopoiesis during stress
GSE63731	Transcriptome study of P5424 T-cell line
GSE63908	Microarray analysis of Wild-type vs. Brpf1-deficient E8.75 mouse embryo
GSE63909	Microarray analysis of Wild-type vs. Brpf1-deficient P4 mouse brain
GSE64076	Global gene expression profiling of mouse soleus hindlimb muscle following gradual exposure to hypoxia
GSE64130	Transcriptome of mouse mature B cell lines A20 transfected with membrane IgE
GSE64238	Metabolic adaptation of white adipose tissue to acute, short-term environmental oxygen restriction in mice
GSE64251	Jmjd2a and Jmjd2c regulate H3K9me3 and H3K36me3 at H3K4me3 positive TSSs being essential for ESC self-renewal and embryogenesis (microarray)
GSE64254	Jmjd2a and Jmjd2c regulate H3K9me3 and H3K36me3 at H3K4me3 positive transcription start sites being essential for ESC self-renewal and embryogenesis
GSE64307	Gene expression in brain of interleukin-18 knockout mice at 6 and 12 weeks of age
GSE64308	Gene expression in brown adipose tissue of interleukin-18 knockout mice at 6 and 12 weeks of age
GSE64309	Gene expression in liver of interleukin-18 knockout mice at 6 and 12 weeks of age
GSE64310	Gene expression in kidney of interleukin-18 knockout mice at 6 and 12 weeks of age
GSE64498	Gene expression comparison of post-sepsis versus naïve mice-derived tumor associated macrophages
GSE64541	Cell stage dependent transcriptional response to leukemic oncogene
GSE64556	Retinoic acid signaling coordinates the behavior of multiple cell lineages during cardiac outflow morphogenesis
GSE64625	RUNX1/ETO role's in hematopoietic system
GSE64861	Gene expression profile of Mef2d KO retina at P14
GSE66073	Gene expression of APJ deficient endothelial cell
GSE66085	RANK-Fc treatment in MMTV-PyMT late carcinoma
GSE66971	Gata6 induced XEN-like cells w/o Sox7
GSE67687	Fibrogenic cell plasticity blunts tissue regeneration and aggravates muscular dystrophy
GSE67696	Development of gene expression signatures for colonic lamina propria DCs of CD300a deficient mice
GSE67847	Identification of a potent and selective chemical probe for exploring the role of Mediator complex-associated protein kinases CDK8 and CDK19 in human disease [beta-catenin organoids]
GSE67849	Identification of a potent and selective chemical probe for exploring the role of Mediator complex-associated protein kinases CDK8 and CDK19 in human disease
GSE67967	Gene expression profiling of Nup98HoxA9 expressing ES cells
GSE68074	Lentiviral vector-based microRNA sponges identifies miR-155 and miR-802 target genes in the hippocampus of Ts65Dn mice
GSE68187	Targeted activation of CREB in reactive astrocytes is neuroprotective in focal acute cortical injury.
GSE68211	PRC2 mediates paternal epigenetic inheritance: comparison of wild-type embryos
GSE68212	PRC2 mediates paternal epigenetic inheritance: comparison of heterozygous mutant embryos
GSE68213	PRC2 mediates paternal epigenetic inheritance
GSE68420	The role of aquaporin-3 (AQP3) in functions of alveolar macrophage (AM) during ovalbumin (OVA)-induced asthma
GSE68505	ATM-deficient B cell lymphomas
GSE68880	Comparison of ectopic gene expression in Cdx1+/+ and Cdx1-/- thymic medullary epithelial cells
GSE69038	Murine Neural Stem/Progenitor Cells: Control vs.PJ34
GSE69117	LR11 knockout in BAT and WAT
GSE69640	The C-terminal region of Xpc is dispensable for the transcriptional activity of Oct3/4 in mouse embryonic stem cells
GSE69804	Gene expression analysis of WT, HBZ-Tg, IFNgKO, and HBZ-Tg/IFNg KO mice.
GSE70015	MacroH2A1.1 regulates mitochondrial respiration by limiting nuclear NAD+ consumption
GSE70129	miR-153 overexpressing NSPCs derived from mouse ES cells
GSE70131	MicroRNA-153 regulates the acquisition of gliogenic competence by neural stem cells
GSE70376	Genome-wide expression analysis of quiescent versus activated muscle stem cells (satellite cells)
GSE70405	Binary cell fate decision as high-dimensional critical state transition
GSE70444	Effect of LXR activation on LPS-induced inflammatory response in primary bone marrow macrophages from ABCA1fl/fl LysM Cre and control wildtype mice
GSE70463	Effect of LXR activation on LPS-induced inflammatory response in immortalized bone marrow macrophages from LXRa/b knockout mice stably expressing LXR wildtype, K328R/K434R or L439A/E441A mutant
GSE70829	Gfi1, a transcriptional repressor, inhibits the induction of the T helper type 1 programme in activated CD4 T cells
GSE70894	The transcriptional repressor Gfi1 inhibits the induction of Th1 program in activated CD4 T cells
GSE71631	Determining the effects of the loss of sympathetic drive in bone, hypothalamus, and gut in adrenergic B1 and B2 receptor knockout mice [bone]
GSE71632	Determining the effects of the loss of sympathetic drive in bone, hypothalamus, and gut in adrenergic B1 and B2 receptor knockout mice [distal colon]
GSE71633	Determining the effects of the loss of sympathetic drive in bone, hypothalamus, and gut in adrenergic B1 and B2 receptor knockout mice [hypothalamus]
GSE71749	Muscle mitochondrial stress-induced metabolic adaptations do not require FGF21 action
GSE72007	Development of gene expression signatures for murine bladder: Control vs. UTI89
GSE72504	Comparison of testes gene expression in Gipr–/– and Gipr+/+
GSE72549	Gene expression profiling of prostate tissues and seminal vesicles from PB-Pten-NICD mice
GSE72635	Gene expression signature of HoxA9-Meis1 AML cells treated with Pyrydopyrazine
GSE73173	Effect of exogenous FABP4 (A-FABP/aP2) with and without palmitic acid on gene expression in RAW264.7 macrophages
GSE73496	Gene expression analysis of primitive erythroid progenitors from 5-FU-treated WT and ESAM-KO mice.
GSE73733	Gene expression profiling of novel glucocorticoids in RAW264.7 cells
GSE73758	s-SHIP expression identifies a subset of murine basal prostate cells as neonatal stem cells
GSE74066	Gene expression changes associated with exposure to BHPF in mice
GSE74282	Deletion of nuoG in recombinant BCG vaccine against TB
GSE75123	Leukocyte-Specific Protein1 Regulates T Cell Migration in Rheumatoid Arthritis
GSE75475	Circadian Homeostasis of Liver Metabolism Suppresses Hepatocarcinogenesis
GSE76045	mProx24 cell: control vs diabetic condition (mRNA)
GSE76046	mProx24 cell: control vs diabetic condition
GSE76300	Hyperoxia in FGF10 knock-down mice [AEC II cells]
GSE76301	Hyperoxia in FGF10 knock-down mice [Lung]
GSE76302	Hyperoxia in FGF10 knock-down mice
GSE76469	Pyelonephritis-Mediated Renal Fibrosis is Associated with Severe Inflammation
GSE76660	Gene expression profiles of ASK1-deficient adipose tissues
GSE77527	Flow activated cell sorting and genome-wide analysis of hybrids cells (RFP+YFP+) and non-hybrid cells (RFP+)
GSE77786	Mouse Hepatocytes +/- GW
GSE77802	Mouse Liver LeXis overexpression
GSE77805	Mouse Liver Raly knockdown
GSE77933	Gene expression analysis of RNAs isolated from inguinal White Adipose Tissue (iWAT) of ZIP13-KO mice and their WT littermate mice
GSE78170	Effects of dual agonist of GLP1 and GCGR on animal model of NAS (MCD diet) and hepatic regeneration
GSE78257	MacroH2A1.1 regulates mitochondrial respiration by limiting nuclear NAD+ consumption
GSE78906	FACS-sorted ureteric bud-derivative cells at postnatal day one: wildtype (WT) vs. conditional null (MUT) for Bdkrb2
GSE79084	Mouse hepatoblastoma models with expression of mutant β-catenin and/or c-Myc for therapeutic target identification of childhood liver cancer
GSE79233	Gene expression in primary chondrocytes derived from Rela-cKO/control mice with/without TNF-α treatment
GSE79292	Regulation of normal B cell differentiation and malignant B cell survival by OCT2 (expression)
GSE79482	Regulation of normal B cell differentiation and malignant B cell survival by OCT2
GSE79697	Investigation of Bach2 function by regulating inflammatory response and heme-iron homeostasis of bone marrow macrophage.
GSE79717	Investigation of Bach1 function by heme-iron homeostasis in bone marrow derived macrophage
GSE79806	Investigation of Bach2 function by heme-iron homeostasis in red-pulp macrophage.
GSE80406	Murine lung tissue: Gremlin-1 transgenic vs. wild type
GSE80954	A Bach2-Cebp gene regulatory network for the commitment of multipotent hematopoietic progenitors [expression]
GSE80962	Gene expression for treatment of bioceramic water
GSE81109	Gene expression signatures in mouse epidermis with transglutaminase 1 deficiency
GSE81196	Transcriptional profiling of CD4+ T cells activated in murine malaria.
GSE81242	Gene expression of skeletal muscles in response to overexpression of Notch1 intracellular domain (N1ICD)
GSE81298	Identification of Kdm4a, b and c target genes in MLL-AF9 transformed mouse GMPs (L-GMP) [gene expression]
GSE81300	Identification of Kdm4a, b and c target genes in MLL-AF9 transformed mouse GMPs (L-GMP)
GSE81615	β-cateinin activation in hair follicle dermal sheath induces ectopic hair outgrowth and skin fibrosis
GSE82091	Role of IgD in B cell anergy
GSE83271	Analysis of gene expression signatures between bone marrow derived dendritic cells generated from Wild type or DCIR(Clec4a2) knockout mice infected or not with Mycobacterium tuberculosis
GSE83543	Contribution of Poly-unsaturated Fatty Acids on Cerebral Neurobiology: An Integrated Omics Approach with Epigenomic Focus [expression]
GSE83545	Contribution of Poly-unsaturated Fatty Acids on Cerebral Neurobiology: An Integrated Omics Approach with Epigenomic Focus
GSE83554	Mycobacterium tuberculosis Infection Modulates Adipose Tissue Biology
GSE83815	mRNA expression profile in murine bone marrow-derived macrophages that were isolated from calpain-6 wild-type and deficient mice
GSE83835	Tracking the Fragile X Mental Retardation Protein in a Highly Ordered Neuronal RiboNucleoParticles Population: a Link Between Stalled Polyribosomes and RNA Granules
GSE83984	Mouse iPS cells-derived 3D-retinas: Vehicle control- vs. 4-hydroxytamoxifen (4-OHT)-treated 3D-retinas w/o supplements
GSE83985	Mouse iPS cells-derived 3D-retinas: Vehicle control- vs. 4-hydroxytamoxifen (4-OHT)-treated 3D-retinas
GSE83986	Mouse iPS cells-derived 3D-retinas
GSE84027	Heterogeneity of NKp46+ ILC in skin pre-cancerous lesions
GSE84117	Myeloid Cell Expressed Proprotein Convertase FURIN Attenuates Inflammation
GSE84183	Transcription profiling of dentate gyrus and anterior cingulate cortex in mice exposed Unpredicatble Chronic Mild Stress and treated with fluoxetine
GSE84184	Transcription profiling of blood in mice exposed Unpredicatble Chronic Mild Stress and treated with fluoxetine
GSE84185	Transcription profiling of blood, dentate gyrus and anterior cingulate cortex in mice exposed Unpredicatble Chronic Mild Stress and treated with fluoxetine
GSE84305	FACS-sorted Six2-positive nephron progenitor cells at embryonic day 15.5: wildtype (WT) vs. conditional HDAC1&2-null (MUT)
GSE84781	Polysome profiling: Mouse OT-1 T cells WT vs Lck-/- (OFF)
GSE84855	Total RNA: naïve ex vivo mouse OT-1 T lymphocytes, WT vs Lck-/- (OFF)
GSE84856	Total RNA: 24h activated mouse OT-1 T lymphocytes, WT vs Lck-/- (OFF)
GSE85038	Tead1 is required to maintain adult cardiomyocyte function
GSE85126	Gene expression profiles in the striatum of the R6/2 mouse model of Huntington's disease injected with LNA-oligonucleotides complementary to the CAG repeats (LNA-CTG)
GSE85225	Microarray data of Spred1 WT and KO hematopoietic stem/progenitor cells
GSE85339	Molecular signatures of clinically tested vaccine adjuvants
GSE85711	Inhalation and oropharyngeal aspiration exposure to rod-like carbon nanotubes induces highly similar airway inflammation and biological pathways in mouse lungs
GSE85989	Jmjd2a +/+ vs -/- Pituitary microarray
GSE87075	Gene expression profiles of mouse cervical primary cells
GSE87076	Gene expression profiles of cultured stem cells and organoids from the uterine cervix of human and mouse
GSE87390	Suppression of skin tumorigenesis in CD109-deficient mice
GSE87587	Dek overexpression under the environment exposed to carcinogen in oral squamous cell.
GSE87717	Ago2-RIP-chip in Dicer WT and KO macrophages
GSE87721	Ago2-RIP-chip and miRNA expression profile in Dicer WT and KO macrophages from bone marrow or aorta
GSE88849	Severe damage on placental fetal capillary network causes mid to late fetal lethality and reduction of placental size in Peg11/Rtl1 KO mice [day 10.5]
GSE88891	Severe damage on placental fetal capillary network causes mid to late fetal lethality and reduction of placental size in Peg11/Rtl1 KO mice [day 12.5]
GSE88892	Severe damage on placental fetal capillary network causes mid to late fetal lethality and reduction of placental size in Peg11/Rtl1 KO mice
GSE89023	Post-transcriptional Gene Silencing Mediated by microRNAs is Controlled by Nucleoplasmic Sfpq [Agilent]
GSE89033	Post-transcriptional Gene Silencing Mediated by microRNAs is Controlled by Nucleoplasmic Sfpq
GSE89348	Liver kinase B1 deletion effect on brown adipose tissue
GSE89462	Transcriptomal analysis of mouse healthy skin sample and of DMBA/TPA-induced skin Tumor
GSE89488	Effect of AK144841 SiRNAs on the whole transcriptome of a mouse cell line (mSCC-38 cells) isolated from chemically-induced skin carcinoma (SCC ) (DMBA/TPA model)
GSE89516	AK144841 in Cutaneous Squamous Cell Carcinoma (cSCC)
GSE89998	Effect of prenatal ischemia on gene expression in the mouse cortex
GSE90163	The tumor suppressor menin prevents effector CD8 T cell dysfunction by targeting mTORC1-dependent metabolic activation [Agilent]
GSE90165	The tumor suppressor menin prevents effector CD8 T cell dysfunction by targeting mTORC1-dependent metabolic activation
GSE90995	Interleukin-13 drives cholestasis and compositional changes in the gut microbiome in Abcb4-deficient mice by compromising bile duct barrier integrity
GSE92381	Expression data from mouse naïve (Naive), stem cell memory (TSCM), central memory (TCM) CD4+ T cells
GSE92900	Distinct Sets Of Genes Representing Overlapping Biological Functions Are Altered By Intrinsic Properties Of Carbon Nanomaterials In Vitro And In Vivo [mouse]
GSE92901	Distinct Sets Of Genes Representing Overlapping Biological Functions Are Altered By Intrinsic Properties Of Carbon Nanomaterials In Vitro And In Vivo
GSE92944	Inhibitory effect of microRNA on carcinogenesis of colorectal cancer using CDX2P-NLS Cre;Apc+/loxP (CPC-Apc) mice (mRNA)
GSE92974	Inhibitory effect of microRNA on carcinogenesis of colorectal cancer using CDX2P-NLS Cre;Apc+/loxP (CPC-Apc) mice
GSE93151	Different lipid forms of omega-3 and their effect on small intestine in mice
GSE93564	Oncogene-induced senescence in primary mouse keratinocytes
GSE93966	The major patterns of changes in gene expression in mouse B cells in response to the latent membrane protein 1 (LMP1) of Epstein-Barr virus (EBV) in B cells gene expression
GSE94506	Establishment of stably expandable induced myogenic stem cells by defined factors
GSE94647	Analysis of gene expression in populations of adult undifferentiated spermatogonia [microarray]
GSE95064	Mouse ES Cells: Control vs Hottip_VP160 and Hoxa13
GSE95209	Gene expression profile of Samd7 KO retina at P12
GSE95786	Identification of a myofibroblast-specific expression signature in skin wounds
GSE96926	Transcriptome analysis of Arid1a-deficient IPMN and Brg1-deficient IPMN
GSE97314	Microarray analysis of mouse skeletal muscle atrophied by aging
GSE97315	Microarray analysis of atrophied skeletal muscle models
GSE97363	Genome-wide analysis of gene expression from murine right ventricle subjected to pressure and volume loading (PSPI)
GSE97759	Transcriptional impairments in mouse model of mucopolysaccharidosis IIIA and responses to systemic gene delivery using adeno-associated virus serotype rh74 vector (AAVrh74)
GSE97825	Impact of miR-199a-5p silencing on bleomycin-induced lung fibrosis
GSE97826	Impact of CAV1 target site blocker (CAV1 TSB) on bleomycin-induced lung fibrosis
GSE97834	The DNM3OS lncRNA is a reservoir of fibromiRs with major functions in fibroblast response to TGF-beta and fibrogenesis
GSE98228	Human Yes Associated Protein (hYAP) expressing mouse liver (set 1)
GSE98229	Human Yes Associated Protein (hYAP) expressing mouse liver (set 2)
GSE98231	Human Yes Associated Protein (hYAP) expressing mouse liver
GSE98452	Liver progenitor cell response to human amniotic epithelial cell conditioned media
GSE98570	Whole transcriptome analysis of induced cardiomyocytes during direct cardiac reprogramming [expression]
GSE98571	Analysis of induced cardiomyocytes during direct cardiac reprogramming
GSE98783	Transcriptional profile of organ fibroblasts from adult mice
GSE98799	Differential Gene Expression Analysis with Altered Local CRH Signaling in the Mouse Olfactory Bulb
GSE99359	Gene analysis of ameloblasts in Sox21KO
GSE99360	P0 wild type tooth and skin
GSE99814	Comparative gene expression analyses reveal distinct molecular signature between differentially reprogrammed cardiomyocytes
GSE100046	Activity-dependent neuronal Klotho enhances astrocytic aerobic glycolysis
GSE100313	Early gestational maternal low-protein diet diminishes hepatic response to fasting in young adult male mice
GSE100700	Comparison of gene expression between Ftx KO eyes and wild type eyes
GSE100847	Gene expression analysis on renal tubule epithelial cells, mIMCD3, with or without FGF23 stimulation.
GSE102027	Gene expression profiles from islets of a β-cell-specific CB1-knockout mice
GSE102513	Tacrolimus-induced nephrotoxicity in mice is associated with microRNA deregulation [transcriptome analysis]
GSE102515	Tacrolimus-induced nephrotoxicity in mice is associated with microRNA deregulation
GSE103159	Gene expression alteration in mouse primary chondrocytes by cyclic tensile strain.
GSE103936	CD157 positive endothleilal stem cells in the liver
GSE104079	Metabolic and Molecular Framework for the Enhancement of Endurance by Intermittent Fasting
GSE104627	Gene expression profiling in liver normal and tumor tissues in C3H mice
GSE105117	1,25(OH)D3 effect on colonic organoids from wt and VDR KO mice
GSE106141	Roles of Cdc42 and Rac in Bergmann glia during cerebellar corticogenesis (WT_primary_astrocyte)
GSE106143	Roles of Cdc42 and Rac in Bergmann glia during cerebellar corticogenesis
GSE107108	Gene expression in MLE-12 cells transfected with microRNA (miRNA; miR) mimics upon influenza virus infection
GSE107139	Transcript levels in the normal epithelium and adenomas of the colon of Min mice
GSE107142	IRF2 maintains the stemness of colonic stem cells by limiting physiological stress from interferon
GSE107256	Analysis of gene expression in populations of adult undifferentiated spermatogonia
GSE107314	Endogenous hippocampal leptin in mediating strong potentiation by Astaxanthin supplementation for mild exercise-enhanced neurogenesis and memory functions
GSE107702	Introduction of the TERT and BMI1 Genes into Murine Dermal Papilla Cells Ameliorates Hair Inductive Activity
GSE108299	Time resolved and interorgan response of mice to systemic energetic starvation
GSE108379	Overexpression of CYB5R3 and NQO1, two NAD+ producing enzymes, mimics aspects of caloric restriction
GSE108485	Gene expression analysis of the hippocampus in Il18+/+ and Il18-/- mice at 12 weeks of age
GSE108826	Abnormal microglia and enhanced inflammation-related gene transcription in mice with conditional deletion of Ctcf in Camk2a-Cre-expressing neurons [RPL_HC_CTCF]
GSE108827	Abnormal microglia and enhanced inflammation-related gene transcription in mice with conditional deletion of Ctcf in Camk2a-Cre-expressing neurons
GSE109055	NAD+ supplementation normalizes key Alzheimer’s features and DNA damage in a new AD mouse model with introduced DNA repair deficiency
GSE109327	Genetic ablation of miR-33 increases food intake, enhances adipose tissue expansion, and promotes obesity and insulin resistance
GSE109741	Muscle cannabinoid 1 receptor regulates Il-6 and myostatin expression, governing physical performance and whole-body metabolism.
GSE110285	Gene expression in the murine liver, effect of hepatic expression of Niemann-Pick C1-like 1 protein.
GSE110662	Erk-dependent transcriptome
GSE110664	Erk regulated mRNA degradation
GSE110670	Differential gene expression changes to oral immunotherapy by a multi-antigenic peptide at different time points of atherosclerotic disease progression
GSE110920	FACS-sorted GFP-positive ureteric bud (UB) cells at postnatal day 0 (P0): wildtype (WT) vs. conditional Dot1-knockout (KO) from Hoxb7-positive cells
GSE110928	Whole kidneys at embryonic day 16.5: wildtype (WT) vs. conditional Dot1-knockout (KO) from Six2-positive nephron progenitor cells (NPC)
GSE111940	Hydroxyurea protects hippocampal neurons against oxidative, metabolic and excitotoxic stress, and improves spatial memory in a mouse model of Alzheimer’s disease (Mouse)
GSE111943	Hydroxyurea attenuates oxidative, metabolic, and excitotoxic stress in rat hippocampal neurons and improves spatial memory in a mouse model of Alzheimer’s disease
GSE112287	The role of NOXO1 in the mouse model of cigarette smoke-induced emphysema and pulmonary hypertension
GSE112653	Identifying pre-disease signals before metabolic syndrome in mice by dynamical network biomarkers
GSE112827	Impact of Dnm3os silencing on bleomycin-induced lung fibrosis
GSE112831	Effect of cinacalcet HCL on gene expression in mouse kidney
GSE113102	Fgf10 knock-down effects in hyperoxia
GSE113103	Fgf10 knock-down effects in normoxia
GSE113104	Fgf10 knock-down effects in hyperoxia and normoxia
GSE113251	Deletion of Nkx2-5 in trabecular myocardium reveals the developmental origins of pathological heterogeneity associated with ventricular non-compaction cardiomyopathy
GSE113376	Tissue and host species specific trasncriptional changes in models of experimental visceral leishmaniasis
GSE114352	Analysis of gene expression profile in LPS-stimulated Maf-deficient BMDM
GSE116483	The white adipose tissue transcriptional response to withdrawal of vitamin B3
GSE116714	Skeletal muscle of Eif6 heterozygous mice - soleus
GSE116715	mRNA loading on polysomes in skeletal muscle of Eif6 heterozygous mice
GSE117088	The analysis of gene expression in hematopietic stem/progenitor cells (HSPCs; LSK cells, Lineage-, c-kit+, Sca-1+) from diabetic/nondiabetic mice.
GSE117122	Gene expressions of TCRαβ+ CD8αα+ intraepithelial lymphocyte (IELs) in the small intestine with or without Rbpj gene
GSE119464	CD45- sorted tumor cells from RANK+/+ and RANK-/- MMTV_PYMT late carcinomas
GSE119725	Differential effects of a glucagon-like peptide 1 receptor agonist in NAFLD and in response to hepatectomy
GSE121852	Src modulates its oncogenic signaling via regulation of miRNA-129-3p [mRNA]
GSE121854	Src modulates its oncogenic signaling via regulation of miRNA-129-3p
GSE122053	Gene expression profile in mouse skeletal muscle after Mettl21c deletion
GSE123737	Gene expression profiles of liver tissues (normal, non-tumor and tumor tisuues) of F2 males of C3H mice born to F1 mice gestationally exposed to arsenite
GSE124154	Primary target of Fgf10 in embryonic mouse lung
GSE124157	A comprehensive analysis of fibroblast growth factor receptor 2b signalling on epithelial tip progenitor cells during early mouse lung branching morphogenesis
GSE125815	Microarray analysis of skeletal muscle in aged mice
GSE126157	Effects of cordycepin on murine macrophage-like cells in the presence and absence of an inflammatory stimulus
GSE129443	Gene expression profile of Otx2 KI and Crx KO retina at P12
GSE130123	Intrahepatic lipocalin 2 promotes liver fibrosis in alcoholic hepatitis [array]
GSE130129	Intrahepatic lipocalin 2 promotes liver fibrosis in alcoholic hepatitis
GSE131163	Effects of Meflin(islr) depletion on the global gene expression profiles in mouse MSCs
GSE131175	Gene expression analysis of micoRNA-221 overexpressing transgenic mice livers with and without metformin intervention upon chronic liver injury induced by carbon tetrachloride
GSE131643	Tox reinforces the phenotype and longevity of exhausted T-cells in chronic viral infection
GSE132028	Tox reinforces the phenotype and longevity of exhausted T-cells in chronic viral infection [day28 acute vs chronic]
GSE132444	Dynamic Lineage Priming by ERK is Driven by Transcription Factor-Independent Enhancer Regulation
GSE132918	Identification of Rfx6-regulated genes in mouse embryonic small intestine by microarrays
GSE132919	Identification of Rfx6-regulated genes in mouse embryonic small intestine endocrine cells by microarrays
GSE133033	Gene expression profiles of FoxO4 overexpressing TH1 cells.
GSE133035	Foxo4 transcriptional factor represses TH1 cell differentiation and effector function by regulating Dickkopf-3 production
GSE133038	Rfx6-regulated genes in the mouse intestine
GSE136792	Impaired adult hippocampal neurogenesis in a mouse model of familial hypercholesterolemia: a role for the LDL receptor and cholesterol metabolism in adult neural precursor cells (LDL treatment)
GSE136797	Impaired adult hippocampal neurogenesis in a mouse model of familial hypercholesterolemia: a role for the LDL receptor and cholesterol metabolism in adult neural precursor cells (LDLR Knockdown)
GSE136798	Impaired adult hippocampal neurogenesis in a mouse model of familial hypercholesterolemia: a role for the LDL receptor and cholesterol metabolism in adult neural precursor cells
GSE140799	Tissue-specific transcriptomic changes associated with AmBisome treatment of mice with experimental visceral leishmaniasis [LV9]
GSE141131	Transgenic expression of human C19MC miRNAs impacts placental morphogenesis
GSE141282	mir-154 in mouse lung development - E18.5 in vivo data
GSE141292	mir-154 in mouse lung development - pull-down RNA
GSE141300	Identification of miR-154 downstream targets
GSE142109	Gene expression profiling of murine renal adenocarcinoma cells during recursive implantations
GSE143420	Comparision of hepatic gene expression between fasted and fed ad lib states in C57B6J (WT) and CREBH KO mice
GSE143421	Comparision of hepatic gene expression between HFHS diet-fed WT and CREBH-Tg mice
GSE143715	RANKL-RANK activation in mmtv-Pymt primary tumor cultures
GSE145343	Hepatic transcriptomics of squalene in male Apoe-deficient mice on Western diet
GSE145952	Chromatin Protein PC4 Orchestrates B Cell Differentiation by Collaborating with IKAROS and IRF4 (Agilent microarrays)
GSE145953	Chromatin Protein PC4 Orchestrates B Cell Differentiation by Collaborating with IKAROS and IRF4
GSE146919	Microarray analysis of transgenic mice specifically overexpressing FOXO1 in skeletal muscle (FOXO1 Tg mice)
GSE148167	Evolutionary Origin of Vertebrate Oct4/POUV Functions in Supporting Pluripotency
GSE148309	Hepatocyte CB1R nullification mitigates acute liver damage by mediating NF-κB signaling
GSE149478	Effect of the USP7 inhibitor HBX41,108 on lipopolysaccharide induced gene expression in mouse bone marrow derived macrophages.
GSE153344	Microarray-based transcriptome profiling after H19 KO
GSE153814	Lionheart LincRNA Alleviates Cardiac Systolic Dysfunction under Pressure Overload
GSE158236	Expression data from cardiac myofibroblasts culutured on plastic plates or in suspension
GSE160185	Expression data from 3-month-old mouse hippocampus of Ts1Cje and wild-type mice
GSE161399	AKT signaling promotes epigenetic reprogramming via upregulation of TET and its cofactor, alpha-ketoglutarate during iPSC generation
GSE161618	Molecular etiology behind spaceflight-induced impediment of male mouse bone fracture repair
GSE164094	Gene expression signatures to the radiation attenuated Schistosome Vaccine
GSE164731	Comparison of gene expression in hippocampus among three strains (SAMP8, SAMR1 and JF1) of mice
GSE164955	Tumor-Derived Thymic Stromal Lymphopoietin Expands Bone Marrow B-cell Precursors in Circulation to Support Metastasis
GSE165111	Gene expression profile of brain and hippocampus of B-cell sufficient and B-cell deficient 3xTgAD mice
GSE166534	MicroRNA-21 controls the circadian regulation of apoptosis in atherosclerotic lesions
GSE167248	T cell-intrinsic prostaglandin E2-EP2/EP4 signaling is critical in pathogenic Th17 cell-driven inflammation
GSE167413	Murine macrophages: Peritoneal exudate macrophages (PECs) vs tumor-associated macrophages (TAMs)
GSE171875	Gene expression profiles of normal and activity-silenced mitral cells at P3 and P6
GSE175622	Age-dependent impact of two exercise training regimens on genomic and metabolic remodeling in skeletal muscle and liver of male mice
GSE178199	Mouse whole brain: Alteration of gene expression caused by prenatal titanium dioxide nanoparticle exposure
GSE178207	Mouse whole brain: Molecular alterations caused by prenatal titanium dioxide nanoparticle exposure
GSE180507	Phosphorylation-resistant Rb knockin mice develop diabetes that can be attenuated by vitamin C
GSE181409	Gene expression profiles of mouse derived esophagus and stomach epithelial stem cells 3D organoids
GSE183049	Evolutionary Origin of Vertebrate Oct4/POUV Functions in Supporting Pluripotency
GSE184739	Hematopoietic stem cells (HSCs) and multipotent progenitors (MPPs)
GSE185150	Transcriptional response in a sepsis mouse model reflects transcriptional response in sepsis patients
GSE189247	Superoxide dismutase-3 downmodulates laminin α5 expression in endothelial cells via Nuclear Factor kappa B signaling inhibition
GSE189326	SENP2 suppresses browning of white adipose tissues by de-conjugating SUMO from C/EBPβ
GSE193520	Aberrant expression and localization of the RAP1 shelterin protein contributes to age-related phenotypes [2017]
GSE193523	Aberrant expression and localization of the RAP1 shelterin protein contributes to age-related phenotypes [2019]
GSE193524	Aberrant expression and localization of the RAP1 shelterin protein contributes to age-related phenotypes
GSE194292	RNA-Seq of NIH-3T3 cells treated with CMA modulators
GSE197563	Oligodendrocyte and microglia transcriptome analysis in a mouse model of encephalopathy of prematurity induced by systemic inflammation
GSE199821	Protection of mouse by blockade to TNF-α signaling is due to inhibition against IL-17A
GSE200409	Hepatic gene expression and functional changes associated with nonalcoholic steatohepatitis
GSE202215	Effects of e-cigarette smoke on transcription profiles of PASMCs and AECII in mice
GSE204718	Contribution of Poly-unsaturated Fatty Acids on Cerebral Neurobiology: An Integrated Omics Approach with Epigenomic Focus [Agilent]
GSE208000	Transdifferentiating alveolar macrophages characterized by Placenta-expressed transcript 1 (Plet1) expression
GSE210517	Protective role of gut insulin action in the development of nonalcoholic steatohepatitis and hepatocellular carcinoma associated with diabetes in mice
GSE221113	Time-course transcriptome of developing brown adipose tissue
GSE222444	Gene expression signatures to the radiation attenuated Schistosome Vaccine
GSE223408	Dual targeted extracellular vesicles regulating oncogenic genes in pancreatic cancer [Mouse Array]
GSE223409	Dual targeted extracellular vesicles regulating oncogenic genes in pancreatic cancer
GSE224543	Identification of genes enriched in Nkx2-1-positive neurons in the Arc, VMH, and DMH of adult mice
GSE224690	The comparison of gene expression in hematopietic stem cells (HSCs; LSK cells, Lineage-, c-kit+, Sca-1+) from STZ-indued diabetic/nondiabetic mice.
GSE227002	Differentiated embryonic neurospheres from familial Alzheimer’s disease model show Innate Immune and Glial Cell Responses
GSE228719	Metabolic adaptation of skeletal muscle to acute, short-term environmental oxygen restriction in mice
GSE246792	Bradykinin promotes immune responses in differentiated embryonic neurospheres carrying APP swe and PS1 dE9 mutations
GSE250286	Gene expression in the placenta, and cerebral cortex of the brain of offspring mice; effect of maternal exposure to carbon black nanoparticle and ascorbic acid pre-treatment

Relations

Alternative to

GPL10787

Data table header descriptions
ID	Agilent Feature Number
COL	Column
ROW	Row
NAME	Name
SPOT_ID	Spot identifier
CONTROL_TYPE	Control type
GB_ACC	GenBank or RefSeq accession
GENE_ID	NCBI Gene ID
GENE_SYMBOL	Gene symbol
GENE_NAME	Gene name
UNIGENE_ID	UniGene ID
ENSEMBL_ID	Ensembl ID
ACCESSION_STRING	Accession string
CHROMOSOMAL_LOCATION	Chromosomal location
CYTOBAND	Cytoband
DESCRIPTION	Description
GO_ID	GoIDs
SEQUENCE	Oligo sequence

Data table

COL

ROW

NAME

SPOT_ID

CONTROL_TYPE

GB_ACC

GENE_ID

GENE_SYMBOL

GENE_NAME

UNIGENE_ID

ENSEMBL_ID

ACCESSION_STRING

CHROMOSOMAL_LOCATION

CYTOBAND

DESCRIPTION

GO_ID

SEQUENCE

192

328

GE_BrightCorner

pos

192

326

DarkCorner

pos

192

324

DarkCorner

pos

192

322

A_55_P2051983

FALSE

NM_001001803

408198

Spink7

serine peptidase inhibitor, Kazal type 7 (putative)

Mm.478742

ENSMUST00000076194

ref|NM_001001803|ens|ENSMUST00000076194|gb|BC148575|gb|BC156750

chr18:62753954-62753895

mm|18qE1

Mus musculus serine peptidase inhibitor, Kazal type 7 (putative) (Spink7), mRNA [NM_001001803]

CAGTTTGTGGATCTGACTATATCACTTACGGGAATAAATGCAAGCTGTGTACAGAGATCT

192

320

A_52_P169082

FALSE

NM_021294

13168

Dbil5

diazepam binding inhibitor-like 5

Mm.347413

ref|NM_021294

chr11:76031955-76032014

mm|11qB5

Mus musculus diazepam binding inhibitor-like 5 (Dbil5), mRNA [NM_021294]

GO:0000062(fatty-acyl-CoA binding)|GO:0005488(binding)|GO:0005737(cytoplasm)|GO:0006810(transport)|GO:0008289(lipid binding)

TAAACAAAGGGATGTCCAAGATGGATGCCATGAGGATCTACATTGCTAAAGTGGAAGAGC

192

318

A_30_P01028193

FALSE

chr14:47978277-47985238_F

chr14:47982421-47982480

mm|14qC1

lincRNA:chr14:47978277-47985238 forward strand

CCATTAGAGCTGACTCCAAGCCATCAGTCCCAACGAGGAATGGTGAATTGGCTTCATCTA

192

316

A_52_P237997

FALSE

NM_177274

320840

Negr1

neuronal growth regulator 1

Mm.317293

ref|NM_177274

chr3:156834624-156834683

mm|3qH4

Mus musculus neuronal growth regulator 1 (Negr1), transcript variant 2, mRNA [NM_177274]

GTGGAGCTTCCATATCCAAAATCGTGCAACTGGGATTTTTCTACAGACACACAAGTTAGC

192

314

A_51_P414243

FALSE

NM_153540

215494

C85492

expressed sequence C85492

Mm.402151

ENSMUST00000084743

ref|NM_153540|ens|ENSMUST00000084743|gb|AK042747|gb|AK133802

chr9:121890800-121890741

mm|9qF4

Mus musculus expressed sequence C85492 (C85492), mRNA [NM_153540]

TAATCTTTGAATTTCATCTGTAGCTGAGTGACAGGTGTGTTTGGAGCAGTCATTAAATGA

192

312

A_55_P2136348

FALSE

NM_007720

12776

Ccr8

chemokine (C-C motif) receptor 8

Mm.442098

ENSMUST00000048777

ref|NM_007720|ens|ENSMUST00000048777|gb|BC101966|gb|BC101967

chr9:120003293-120003352

mm|9qF4

Mus musculus chemokine (C-C motif) receptor 8 (Ccr8), mRNA [NM_007720]

ATGTTCTTCATCACCCTAATGAGTGTGGACAGGTATCTGGCTATTGTCCACGCTGTCTAT

192

310

A_51_P108228

FALSE

NM_007390

11441

Chrna7

cholinergic receptor, nicotinic, alpha polypeptide 7

Mm.113464

ENSMUST00000032738

ref|NM_007390|ens|ENSMUST00000032738|gb|AK157809|gb|L37663

chr7:70244064-70244005

mm|7qC

Mus musculus cholinergic receptor, nicotinic, alpha polypeptide 7 (Chrna7), mRNA [NM_007390]

CGAGAATTGGGGTCCTAACTCTACATTGTGATAAATGGAAGAACTCTGAGGTATCCCTGT

192

308

A_30_P01033363

FALSE

chr7:134807861-134809001_R

chr7:134808751-134808692

mm|7qF3

lincRNA:chr7:134807861-134809001 reverse strand

GGGGAACTTCAAGTAACAAACATTTATTAATTAGACTTCTGAACTACCAATGGGGCAGAA

192

306

A_55_P2049737

FALSE

CA465559

Mm.415064

gb|CA465559|tc|TC1721584

chr2:171041086-171041027

mm|2qH3

AGENCOURT_10728649 NIH_MGC_169 Mus musculus cDNA clone IMAGE:6773657 5', mRNA sequence [CA465559]

ATACATAAATGATACATCTTCGCTGATCTCGGCTAGCAGTGCCATGTCACTTCTGCAGCT

192

304

A_30_P01024440

FALSE

chr17:3213918-3257944_F

chr17:3257885-3257944

mm|17qA1

lincRNA:chr17:3213918-3257944 forward strand

TCTCAGGCGCGGTTTCTGATTGAATGCAGAGGTCACACGCATGCCTCCCTGTATTACCTG

192

302

A_30_P01025554

FALSE

chr8:72663591-72671154_F

chr8:72671094-72671153

mm|8qB3.3

lincRNA:chr8:72663591-72671154 forward strand

AGGGTCACTCTTCCAGGAGCATTCACATAACAGTCTTTGTGCACTGAATACACTGACTGT

192

300

A_30_P01031558

FALSE

chr17:13812666-13820504_R

chr17:13812739-13812680

mm|17qA1

lincRNA:chr17:13812666-13820504 reverse strand

TTGAAGGGGAAGAGCAGAGACCTCACACTGTACAGAGGCCATGCCTGTCACAGGCTAGTC

192

298

A_30_P01030675

FALSE

chr6:67054389-67054857_F

chr6:67054547-67054606

mm|6qC1

lincRNA:chr6:67054389-67054857 forward strand

TCTGTTGCATCTGAATCCTTCCATTGTTTTGGAACAATGCTGTCAGATGCAAGTGCCCTG

192

296

A_51_P328014

FALSE

NM_011991

26572

Cops3

COP9 (constitutive photomorphogenic) homolog, subunit 3 (Arabidopsis thaliana)

Mm.40

ENSMUST00000019517

ref|NM_011991|ens|ENSMUST00000019517|gb|AK142318|gb|AK169747

chr11:59634853-59633613

mm|11qB1.3

Mus musculus COP9 (constitutive photomorphogenic) homolog, subunit 3 (Arabidopsis thaliana) (Cops3), mRNA [NM_011991]

CCGTGTACAGTTATCTGGACCACAGGAGGCAGAAAAATATGTTCTACACATGATAGAAGA

192

294

A_30_P01019108

FALSE

chr3:4797557-4798821_F

chr3:4797836-4797895

mm|3qA1

lincRNA:chr3:4797557-4798821 forward strand

TATCTGCTAAGCATTGCAGCTCCTGTGCCCTTCTACACATTTTTATTTCCAGAGAAGGTA

192

292

A_55_P2056220

FALSE

unmapped

ATTTCTTCTGTTCCACTCTGTGCACATGGCGTTTCAGGGTACGAGGTGTAGCATCTTTAT

192

290

A_55_P1985764

FALSE

chr11:041314267-041314326

mm|11qA5

TTTTGTTAGCATCAGGACTGTAGTGCTGTGTCACCACATGAGAGTTCAGAAGCAGCCTTT

Total number of rows: 62976

Table truncated, full table size 28789 Kbytes.

Download family	Format
SOFT formatted family file(s)	SOFT
MINiML formatted family file(s)	MINiML

Supplementary file	Size	Download	File type/resource
GPL13912_old_annotations.txt.gz	7.9 Mb	(ftp)(http)	TXT